data_50351 ####################### # Entry information # ####################### save_entry_information_1 _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information_1 _Entry.ID 50351 _Entry.Title ; Assignment of base 15N, 13C and 1H chemical shifts for 5_SL6 ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2020-06-23 _Entry.Accession_date 2020-06-23 _Entry.Last_release_date 2020-06-23 _Entry.Original_release_date 2020-06-23 _Entry.Origination author _Entry.Format_name . _Entry.NMR_STAR_version 3.2.6.0 _Entry.NMR_STAR_dict_location . _Entry.Original_NMR_STAR_version 3.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype solution _Entry.Source_data_format . _Entry.Source_data_format_version . _Entry.Generated_software_name . _Entry.Generated_software_version . _Entry.Generated_software_ID . _Entry.Generated_software_label . _Entry.Generated_date . _Entry.DOI . _Entry.UUID . _Entry.Related_coordinate_file_name . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.ORCID _Entry_author.Entry_ID 1 Harald Schwalbe . . . . 50351 2 Christian Richter . . . . 50351 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 50351 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '13C chemical shifts' 31 50351 '15N chemical shifts' 51 50351 '1H chemical shifts' 99 50351 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2020-07-10 . original BMRB . 50351 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID BMRB 50339 'chemical shifts of the 5_SL5B+C' 50351 BMRB 50340 'chemical shifts of the 5_SL5stem' 50351 BMRB 50341 'chemical shifts of the 3_s2m' 50351 BMRB 50342 'chemical shifts of the 3_SL1' 50351 BMRB 50343 'chemical shifts of the 2_SL3' 50351 BMRB 50344 'chemical shifts of the 5_SL2+3' 50351 BMRB 50346 'chemical shifts of the 5_SL5a' 50351 BMRB 50347 'chemical shifts of the 5_SL4' 50351 BMRB 50348 'chemical shifts of the PK (Pseudoknot)' 50351 BMRB 50349 'chemical shifts of the 5_SL1' 50351 BMRB 50350 'chemical shifts of the 3_SL3base' 50351 BMRB 50352 'chemical shifts of the 5_SL8' 50351 NCBI NC_045512.2 'Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome.' 50351 stop_ save_ ############### # Citations # ############### save_citations_1 _Citation.Sf_category citations _Citation.Sf_framecode citations_1 _Citation.Entry_ID 50351 _Citation.ID 1 _Citation.Name 'citations 1' _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code . _Citation.PubMed_ID . _Citation.DOI . _Citation.Full_citation . _Citation.Title ; Secondary structure determination of conserved SARS-CoV-2 RNA elements by NMR spectroscopy and DMS footprinting analysis ; _Citation.Status 'in preparation' _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full . _Citation.Journal_volume . _Citation.Journal_issue . _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first . _Citation.Page_last . _Citation.Year . _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.ORCID _Citation_author.Entry_ID _Citation_author.Citation_ID 1 Anna Wacker . . . . 50351 1 2 Julia Weigand . E. . . 50351 1 3 Sabine Akabayov . R. . . 50351 1 4 Nadide Altincekic . . . . 50351 1 5 Jasleen 'Kaur Bains' . . . . 50351 1 6 Elnaz Banijamali . . . . 50351 1 7 Oliver Binas . . . . 50351 1 8 Jesus Castillo-Martinez . . . . 50351 1 9 Erhan Cetiner . . . . 50351 1 10 Betul Ceylan . . . . 50351 1 11 Liang-Yuan Chiu . . . . 50351 1 12 Jesse Davila-Calderon . . . . 50351 1 13 Vanessa 'De Jesus' . . . . 50351 1 14 Karthikeyan Dhamotharan . . . . 50351 1 15 Elke Duchardt-Ferner . . . . 50351 1 16 Jan Ferner . . . . 50351 1 17 Lucio Frydman . . . . 50351 1 18 Boris Furtig . . . . 50351 1 19 Jose Gallego . . . . 50351 1 20 'J. Tassilo' Grun . . . . 50351 1 21 Carolin Hacker . . . . 50351 1 22 Christina Haddad . . . . 50351 1 23 Martin Hahnke . . . . 50351 1 24 Martin Hengesbach . . . . 50351 1 25 Fabian Hiller . . . . 50351 1 26 Katharina Hohmann . F. . . 50351 1 27 Daniel Hymon . . . . 50351 1 28 Henry Jonker . . . . 50351 1 29 Heiko Keller . . . . 50351 1 30 Bozana Knezic . . . . 50351 1 31 Tom Landgraf . . . . 50351 1 32 Frank Lohr . . . . 50351 1 33 Luke Luo . . . . 50351 1 34 Klara Mertinkus . R. . . 50351 1 35 Christina Muhs . . . . 50351 1 36 Mihajlo Novakovic . . . . 50351 1 37 Andreas Oxenfarth . . . . 50351 1 38 Martina Palomino-Schatzlein . . . . 50351 1 39 Katja Petzold . . . . 50351 1 40 Stephen Peter . A. . . 50351 1 41 Dennis Pyper . J. . . 50351 1 42 Nusrat Qureshi . S. . . 50351 1 43 Magdalena Riad . . . . 50351 1 44 Christian Richter . . . . 50351 1 45 Krishna Saxena . . . . 50351 1 46 Tatjana Schamber . . . . 50351 1 47 Tali Scherf . . . . 50351 1 48 Judith Schlagnitweit . . . . 50351 1 49 Andreas Schlundt . . . . 50351 1 50 Robbin Schnieders . . . . 50351 1 51 Harald Schwalbe . . . . 50351 1 52 Alvaro Simba-Lahuasi . . . . 50351 1 53 Sridhar Sreeramulu . . . . 50351 1 54 Elke Stirnal . . . . 50351 1 55 Alexey Sudakov . . . . 50351 1 56 Jan-Niklas Tants . . . . 50351 1 57 Blanton Tolbert . S. . . 50351 1 58 Jenny Vogele . . . . 50351 1 59 Lena Weiss . . . . 50351 1 60 Julia Wirmer-Bartoschek . . . . 50351 1 61 Maria 'Wirtz Martin' . A. . . 50351 1 62 Jens Wohnert . . . . 50351 1 63 Heidi Zetzsche . . . . 50351 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_assembly_1 _Assembly.Sf_category assembly _Assembly.Sf_framecode assembly_1 _Assembly.Entry_ID 50351 _Assembly.ID 1 _Assembly.Name 5_SL6 _Assembly.BMRB_code . _Assembly.Number_of_components 1 _Assembly.Organic_ligands 0 _Assembly.Metal_ions 0 _Assembly.Non_standard_bonds no _Assembly.Ambiguous_conformational_states no _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange no _Assembly.Paramagnetic no _Assembly.Thiol_state . _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 5_SL6 1 $entity_1 . . yes native no no . . . 50351 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_entity_1 _Entity.Sf_category entity _Entity.Sf_framecode entity_1 _Entity.Entry_ID 50351 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name entity_1 _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGCACGUCCAACUCAGUUUG CCUGUUUUACAGGUUCGCGA CGUGCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states no _Entity.Ambiguous_chem_comp_sites no _Entity.Nstd_monomer no _Entity.Nstd_chirality no _Entity.Nstd_linkage no _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 46 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic no _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID 1 _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 -2 G . 50351 1 2 -1 G . 50351 1 3 302 C . 50351 1 4 303 A . 50351 1 5 304 C . 50351 1 6 305 G . 50351 1 7 306 U . 50351 1 8 307 C . 50351 1 9 308 C . 50351 1 10 309 A . 50351 1 11 310 A . 50351 1 12 311 C . 50351 1 13 312 U . 50351 1 14 313 C . 50351 1 15 314 A . 50351 1 16 315 G . 50351 1 17 316 U . 50351 1 18 317 U . 50351 1 19 318 U . 50351 1 20 319 G . 50351 1 21 320 C . 50351 1 22 321 C . 50351 1 23 322 U . 50351 1 24 323 G . 50351 1 25 324 U . 50351 1 26 325 U . 50351 1 27 326 U . 50351 1 28 327 U . 50351 1 29 328 A . 50351 1 30 329 C . 50351 1 31 330 A . 50351 1 32 331 G . 50351 1 33 332 G . 50351 1 34 333 U . 50351 1 35 334 U . 50351 1 36 335 C . 50351 1 37 336 G . 50351 1 38 337 C . 50351 1 39 338 G . 50351 1 40 339 A . 50351 1 41 340 C . 50351 1 42 341 G . 50351 1 43 342 U . 50351 1 44 343 G . 50351 1 45 1 C . 50351 1 46 2 C . 50351 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 50351 1 . G 2 2 50351 1 . C 3 3 50351 1 . A 4 4 50351 1 . C 5 5 50351 1 . G 6 6 50351 1 . U 7 7 50351 1 . C 8 8 50351 1 . C 9 9 50351 1 . A 10 10 50351 1 . A 11 11 50351 1 . C 12 12 50351 1 . U 13 13 50351 1 . C 14 14 50351 1 . A 15 15 50351 1 . G 16 16 50351 1 . U 17 17 50351 1 . U 18 18 50351 1 . U 19 19 50351 1 . G 20 20 50351 1 . C 21 21 50351 1 . C 22 22 50351 1 . U 23 23 50351 1 . G 24 24 50351 1 . U 25 25 50351 1 . U 26 26 50351 1 . U 27 27 50351 1 . U 28 28 50351 1 . A 29 29 50351 1 . C 30 30 50351 1 . A 31 31 50351 1 . G 32 32 50351 1 . G 33 33 50351 1 . U 34 34 50351 1 . U 35 35 50351 1 . C 36 36 50351 1 . G 37 37 50351 1 . C 38 38 50351 1 . G 39 39 50351 1 . A 40 40 50351 1 . C 41 41 50351 1 . G 42 42 50351 1 . U 43 43 50351 1 . G 44 44 50351 1 . C 45 45 50351 1 . C 46 46 50351 1 stop_ save_ #################### # Natural source # #################### save_natural_source_1 _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source_1 _Entity_natural_src_list.Entry_ID 50351 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Details _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $entity_1 . 2697049 organism . 'Severe acute respiratory syndrome coronavirus 2' SARS-CoV-2 . . Viruses . Betacoronavirus HCoV-SARS SARS-CoV-2 . . . . . . . . . . . . 50351 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source_1 _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source_1 _Entity_experimental_src_list.Entry_ID 50351 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Details _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $entity_1 . 'reverse transcriptase' . . . . . . . . . . . . . . . . 50351 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 50351 _Sample.ID 1 _Sample.Name 5_SL6 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 5_SL6 '[15N (AC) 15N13C (GU)]' . . 1 $entity_1 . . 600 . . uM . . . . 50351 1 2 'potassium phosphate' 'natural abundance' . . . . . . 25 . . mM . . . . 50351 1 3 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 50351 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 50351 _Sample.ID 2 _Sample.Name 5_SL6 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number 1 _Sample.Solvent_system '5% D2O' _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 5_SL6 '[15N (AC) 15N13C (GU)]' . . 1 $entity_1 . . 600 . . uM . . . . 50351 2 2 'potassium phosphate' 'natural abundance' . . . . . . 25 . . mM . . . . 50351 2 3 KCl 'natural abundance' . . . . . . 50 . . mM . . . . 50351 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_conditions_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_1 _Sample_condition_list.Entry_ID 50351 _Sample_condition_list.ID 1 _Sample_condition_list.Name '5_SL6 298K' _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 75 . mM 50351 1 pH 6.2 . pH 50351 1 pressure 1 . atm 50351 1 temperature 298 . K 50351 1 stop_ save_ save_sample_conditions_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_conditions_2 _Sample_condition_list.Entry_ID 50351 _Sample_condition_list.ID 2 _Sample_condition_list.Name '5_SL6 298K' _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 75 . mM 50351 2 pH 6.2 . pH 50351 2 pressure 1 . atm 50351 2 temperature 298 . K 50351 2 stop_ save_ ############################ # Computer software used # ############################ save_software_1 _Software.Sf_category software _Software.Sf_framecode software_1 _Software.Entry_ID 50351 _Software.ID 1 _Software.Type . _Software.Name LOGS _Software.Version 2.2 _Software.DOI . _Software.Details . loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . collection 50351 1 stop_ save_ save_software_2 _Software.Sf_category software _Software.Sf_framecode software_2 _Software.Entry_ID 50351 _Software.ID 2 _Software.Type . _Software.Name SPARKY _Software.Version 3.114 _Software.DOI . _Software.Details . loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . 'chemical shift assignment' 50351 2 . 'peak picking' 50351 2 stop_ save_ save_software_3 _Software.Sf_category software _Software.Sf_framecode software_3 _Software.Entry_ID 50351 _Software.ID 3 _Software.Type . _Software.Name TOPSPIN _Software.Version 3.6.2 _Software.DOI . _Software.Details . loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . collection 50351 3 stop_ save_ save_software_4 _Software.Sf_category software _Software.Sf_framecode software_4 _Software.Entry_ID 50351 _Software.ID 4 _Software.Type . _Software.Name TOPSPIN _Software.Version 4.0.8 _Software.DOI . _Software.Details . loop_ _Task.Software_module _Task.Task _Task.Entry_ID _Task.Software_ID . collection 50351 4 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer_1 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_1 _NMR_spectrometer.Entry_ID 50351 _NMR_spectrometer.ID 1 _NMR_spectrometer.Name 'Bruker Avance neo 900 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'Bruker Avance neo 900 MHz' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 900 save_ save_NMR_spectrometer_2 _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer_2 _NMR_spectrometer.Entry_ID 50351 _NMR_spectrometer.ID 2 _NMR_spectrometer.Name 'Bruker Avance III HD 700 MHz' _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Bruker _NMR_spectrometer.Model 'Bruker Avance III HD 700 MHz' _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 700 save_ ############################# # NMR applied experiments # ############################# save_experiment_list_1 _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list_1 _Experiment_list.Entry_ID 50351 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 HSQC[13C]-Aromaten no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . 50351 1 2 HCCNH[13C] no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 2 $NMR_spectrometer_2 . . . . . . . . . . . . . . . . 50351 1 3 '2D DARR' no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 4 HSQC[15N]-Amino no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 5 '3D 1H-13C NOESY aromatic' no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 6 TROSY[15N] no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 7 1H-JR[15N] no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 8 HSQC[15N]-2J no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 9 '2D 1H-13C HSQC aliphatic' no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 10 1H-ES no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 11 NOESY[15N]CPMG no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 12 NOESY[15N]-Imino no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 13 HNN-COSY[15N] no . . . . . . . . . . 2 $sample_2 isotropic . . 2 $sample_conditions_2 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 14 '2D 1H-13C HSQC aromatic' no . . . . . . . . . . 1 $sample_1 isotropic . . 1 $sample_conditions_1 . . . 1 $NMR_spectrometer_1 . . . . . . . . . . . . . . . . 50351 1 stop_ save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chem_shift_reference_1 _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chem_shift_reference_1 _Chem_shift_reference.Entry_ID 50351 _Chem_shift_reference.ID 1 _Chem_shift_reference.Name 'Chemical shift reference DSS' _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID C 13 DSS 'methyl protons' . . . . ppm 0.00 na indirect 0.251449530 . . . . . 50351 1 H 1 DSS 'methyl protons' . . . . ppm 0.00 internal direct 1.000000000 . . . . . 50351 1 N 15 DSS 'methyl protons' . . . . ppm 0.00 na indirect 0.101329118 . . . . . 50351 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_assigned_chemical_shifts_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode assigned_chemical_shifts_1 _Assigned_chem_shift_list.Entry_ID 50351 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Name 'Chemical shift list' _Assigned_chem_shift_list.Sample_condition_list_ID 2 _Assigned_chem_shift_list.Sample_condition_list_label $sample_conditions_2 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chem_shift_reference_1 _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID 1 HSQC[13C]-Aromaten . . . 50351 1 2 HCCNH[13C] . . . 50351 1 3 '2D DARR' . . . 50351 1 4 HSQC[15N]-Amino . . . 50351 1 5 '3D 1H-13C NOESY aromatic' . . . 50351 1 6 TROSY[15N] . . . 50351 1 7 1H-JR[15N] . . . 50351 1 8 HSQC[15N]-2J . . . 50351 1 9 '2D 1H-13C HSQC aliphatic' . . . 50351 1 10 1H-ES . . . 50351 1 11 NOESY[15N]CPMG . . . 50351 1 12 NOESY[15N]-Imino . . . 50351 1 13 HNN-COSY[15N] . . . 50351 1 14 '2D 1H-13C HSQC aromatic' . . . 50351 1 stop_ loop_ _Chem_shift_software.Software_ID _Chem_shift_software.Software_label _Chem_shift_software.Method_ID _Chem_shift_software.Method_label _Chem_shift_software.Entry_ID _Chem_shift_software.Assigned_chem_shift_list_ID 2 $software_2 . . 50351 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_assembly_asym_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Ambiguity_set_ID _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 . 1 1 1 G H1' H 1 5.8225 . . 1 . . . . . -2 G H1' . 50351 1 2 . 1 . 1 1 1 G H8 H 1 8.13033 . . 1 . . . . . -2 G H8 . 50351 1 3 . 1 . 1 1 1 G C8 C 13 139.005 . . 1 . . . . . -2 G C8 . 50351 1 4 . 1 . 1 1 1 G N9 N 15 168.507 . . 1 . . . . . -2 G N9 . 50351 1 5 . 1 . 1 2 2 G H1 H 1 13.2962 . . 1 . . . . . -1 G H1 . 50351 1 6 . 1 . 1 2 2 G H1' H 1 5.91067 . . 1 . . . . . -1 G H1' . 50351 1 7 . 1 . 1 2 2 G H8 H 1 7.61175 . . 1 . . . . . -1 G H8 . 50351 1 8 . 1 . 1 2 2 G C1' C 13 92.998 . . 1 . . . . . -1 G C1' . 50351 1 9 . 1 . 1 2 2 G C8 C 13 136.812 . . 1 . . . . . -1 G C8 . 50351 1 10 . 1 . 1 2 2 G N1 N 15 148.439 . . 1 . . . . . -1 G N1 . 50351 1 11 . 1 . 1 2 2 G N9 N 15 169.31 . . 1 . . . . . -1 G N9 . 50351 1 12 . 1 . 1 3 3 C H1' H 1 5.53275 . . 1 . . . . . 302 C H1' . 50351 1 13 . 1 . 1 3 3 C H5 H 1 5.288 . . 1 . . . . . 302 C H5 . 50351 1 14 . 1 . 1 3 3 C H6 H 1 7.69967 . . 1 . . . . . 302 C H6 . 50351 1 15 . 1 . 1 3 3 C H41 H 1 8.52025 . . 1 . . . . . 302 C H41 . 50351 1 16 . 1 . 1 3 3 C H42 H 1 6.84867 . . 1 . . . . . 302 C H42 . 50351 1 17 . 1 . 1 3 3 C N3 N 15 197.129 . . 1 . . . . . 302 C N3 . 50351 1 18 . 1 . 1 3 3 C N4 N 15 98.1474 . . 1 . . . . . 302 C N4 . 50351 1 19 . 1 . 1 4 4 A H1' H 1 5.95875 . . 1 . . . . . 303 A H1' . 50351 1 20 . 1 . 1 4 4 A H2 H 1 7.34911 . . 1 . . . . . 303 A H2 . 50351 1 21 . 1 . 1 4 4 A H8 H 1 8.028 . . 1 . . . . . 303 A H8 . 50351 1 22 . 1 . 1 4 4 A N1 N 15 222.396 . . 1 . . . . . 303 A N1 . 50351 1 23 . 1 . 1 4 4 A N3 N 15 213.339 . . 1 . . . . . 303 A N3 . 50351 1 24 . 1 . 1 5 5 C H1' H 1 5.39533 . . 1 . . . . . 304 C H1' . 50351 1 25 . 1 . 1 5 5 C H5 H 1 5.2034 . . 1 . . . . . 304 C H5 . 50351 1 26 . 1 . 1 5 5 C H6 H 1 7.44989 . . 1 . . . . . 304 C H6 . 50351 1 27 . 1 . 1 5 5 C H41 H 1 8.26167 . . 1 . . . . . 304 C H41 . 50351 1 28 . 1 . 1 5 5 C H42 H 1 6.86067 . . 1 . . . . . 304 C H42 . 50351 1 29 . 1 . 1 5 5 C N3 N 15 197.536 . . 1 . . . . . 304 C N3 . 50351 1 30 . 1 . 1 5 5 C N4 N 15 97.8876 . . 1 . . . . . 304 C N4 . 50351 1 31 . 1 . 1 6 6 G H1 H 1 12.9881 . . 1 . . . . . 305 G H1 . 50351 1 32 . 1 . 1 6 6 G H1' H 1 5.71575 . . 1 . . . . . 305 G H1' . 50351 1 33 . 1 . 1 6 6 G H8 H 1 7.5438 . . 1 . . . . . 305 G H8 . 50351 1 34 . 1 . 1 6 6 G C1' C 13 93.142 . . 1 . . . . . 305 G C1' . 50351 1 35 . 1 . 1 6 6 G C8 C 13 136.248 . . 1 . . . . . 305 G C8 . 50351 1 36 . 1 . 1 6 6 G N1 N 15 147.554 . . 1 . . . . . 305 G N1 . 50351 1 37 . 1 . 1 6 6 G N9 N 15 168.887 . . 1 . . . . . 305 G N9 . 50351 1 38 . 1 . 1 7 7 U H1' H 1 5.5505 . . 1 . . . . . 306 U H1' . 50351 1 39 . 1 . 1 7 7 U H3 H 1 14.336 . . 1 . . . . . 306 U H3 . 50351 1 40 . 1 . 1 7 7 U H5 H 1 5.041 . . 1 . . . . . 306 U H5 . 50351 1 41 . 1 . 1 7 7 U H6 H 1 7.814 . . 1 . . . . . 306 U H6 . 50351 1 42 . 1 . 1 7 7 U C1' C 13 93.774 . . 1 . . . . . 306 U C1' . 50351 1 43 . 1 . 1 7 7 U C5 C 13 102.426 . . 1 . . . . . 306 U C5 . 50351 1 44 . 1 . 1 7 7 U C6 C 13 141.929 . . 1 . . . . . 306 U C6 . 50351 1 45 . 1 . 1 7 7 U N1 N 15 146.748 . . 1 . . . . . 306 U N1 . 50351 1 46 . 1 . 1 7 7 U N3 N 15 162.724 . . 1 . . . . . 306 U N3 . 50351 1 47 . 1 . 1 8 8 C H5 H 1 5.596 . . 1 . . . . . 307 C H5 . 50351 1 48 . 1 . 1 8 8 C H6 H 1 7.81167 . . 1 . . . . . 307 C H6 . 50351 1 49 . 1 . 1 8 8 C H41 H 1 8.4575 . . 1 . . . . . 307 C H41 . 50351 1 50 . 1 . 1 8 8 C H42 H 1 6.92 . . 1 . . . . . 307 C H42 . 50351 1 51 . 1 . 1 8 8 C N3 N 15 198.001 . . 1 . . . . . 307 C N3 . 50351 1 52 . 1 . 1 8 8 C N4 N 15 98.7343 . . 1 . . . . . 307 C N4 . 50351 1 53 . 1 . 1 21 21 C H5 H 1 5.491 . . 1 . . . . . 320 C H5 . 50351 1 54 . 1 . 1 21 21 C H6 H 1 7.82267 . . 1 . . . . . 320 C H6 . 50351 1 55 . 1 . 1 21 21 C H41 H 1 8.554 . . 1 . . . . . 320 C H41 . 50351 1 56 . 1 . 1 21 21 C H42 H 1 6.98733 . . 1 . . . . . 320 C H42 . 50351 1 57 . 1 . 1 21 21 C N3 N 15 197.825 . . 1 . . . . . 320 C N3 . 50351 1 58 . 1 . 1 21 21 C N4 N 15 99.3 . . 1 . . . . . 320 C N4 . 50351 1 59 . 1 . 1 22 22 C H5 H 1 5.54133 . . 1 . . . . . 321 C H5 . 50351 1 60 . 1 . 1 22 22 C H6 H 1 7.82667 . . 1 . . . . . 321 C H6 . 50351 1 61 . 1 . 1 22 22 C H41 H 1 8.4364 . . 1 . . . . . 321 C H41 . 50351 1 62 . 1 . 1 22 22 C H42 H 1 6.94067 . . 1 . . . . . 321 C H42 . 50351 1 63 . 1 . 1 22 22 C N3 N 15 196.779 . . 1 . . . . . 321 C N3 . 50351 1 64 . 1 . 1 22 22 C N4 N 15 98.2448 . . 1 . . . . . 321 C N4 . 50351 1 65 . 1 . 1 23 23 U H1' H 1 5.52525 . . 1 . . . . . 322 U H1' . 50351 1 66 . 1 . 1 23 23 U H3 H 1 13.4929 . . 1 . . . . . 322 U H3 . 50351 1 67 . 1 . 1 23 23 U H5 H 1 5.4395 . . 1 . . . . . 322 U H5 . 50351 1 68 . 1 . 1 23 23 U H6 H 1 7.873 . . 1 . . . . . 322 U H6 . 50351 1 69 . 1 . 1 23 23 U C1' C 13 93.739 . . 1 . . . . . 322 U C1' . 50351 1 70 . 1 . 1 23 23 U C5 C 13 103.476 . . 1 . . . . . 322 U C5 . 50351 1 71 . 1 . 1 23 23 U C6 C 13 141.869 . . 1 . . . . . 322 U C6 . 50351 1 72 . 1 . 1 23 23 U N1 N 15 145.89 . . 1 . . . . . 322 U N1 . 50351 1 73 . 1 . 1 23 23 U N3 N 15 161.948 . . 1 . . . . . 322 U N3 . 50351 1 74 . 1 . 1 24 24 G H1 H 1 12.5177 . . 1 . . . . . 323 G H1 . 50351 1 75 . 1 . 1 24 24 G H1' H 1 5.785 . . 1 . . . . . 323 G H1' . 50351 1 76 . 1 . 1 24 24 G H8 H 1 7.7118 . . 1 . . . . . 323 G H8 . 50351 1 77 . 1 . 1 24 24 G C1' C 13 93.027 . . 1 . . . . . 323 G C1' . 50351 1 78 . 1 . 1 24 24 G C8 C 13 136.552 . . 1 . . . . . 323 G C8 . 50351 1 79 . 1 . 1 24 24 G N1 N 15 147.115 . . 1 . . . . . 323 G N1 . 50351 1 80 . 1 . 1 24 24 G N9 N 15 169.631 . . 1 . . . . . 323 G N9 . 50351 1 81 . 1 . 1 25 25 U H1' H 1 5.73433 . . 1 . . . . . 324 U H1' . 50351 1 82 . 1 . 1 25 25 U H3 H 1 14.001 . . 1 . . . . . 324 U H3 . 50351 1 83 . 1 . 1 25 25 U H5 H 1 5.19875 . . 1 . . . . . 324 U H5 . 50351 1 84 . 1 . 1 25 25 U H6 H 1 7.48914 . . 1 . . . . . 324 U H6 . 50351 1 85 . 1 . 1 25 25 U C1' C 13 90.841 . . 1 . . . . . 324 U C1' . 50351 1 86 . 1 . 1 25 25 U C5 C 13 104.321 . . 1 . . . . . 324 U C5 . 50351 1 87 . 1 . 1 25 25 U C6 C 13 141.509 . . 1 . . . . . 324 U C6 . 50351 1 88 . 1 . 1 25 25 U N1 N 15 143.742 . . 1 . . . . . 324 U N1 . 50351 1 89 . 1 . 1 25 25 U N3 N 15 161.754 . . 1 . . . . . 324 U N3 . 50351 1 90 . 1 . 1 29 29 A H1' H 1 5.86617 . . 1 . . . . . 328 A H1' . 50351 1 91 . 1 . 1 29 29 A H2 H 1 7.965 . . 1 . . . . . 328 A H2 . 50351 1 92 . 1 . 1 29 29 A H8 H 1 8.4532 . . 1 . . . . . 328 A H8 . 50351 1 93 . 1 . 1 29 29 A N1 N 15 224.173 . . 1 . . . . . 328 A N1 . 50351 1 94 . 1 . 1 29 29 A N3 N 15 214.374 . . 1 . . . . . 328 A N3 . 50351 1 95 . 1 . 1 30 30 C H1' H 1 5.714 . . 1 . . . . . 329 C H1' . 50351 1 96 . 1 . 1 30 30 C H5 H 1 5.2544 . . 1 . . . . . 329 C H5 . 50351 1 97 . 1 . 1 30 30 C H6 H 1 7.6026 . . 1 . . . . . 329 C H6 . 50351 1 98 . 1 . 1 30 30 C H41 H 1 8.256 . . 1 . . . . . 329 C H41 . 50351 1 99 . 1 . 1 30 30 C H42 H 1 6.71513 . . 1 . . . . . 329 C H42 . 50351 1 100 . 1 . 1 30 30 C N3 N 15 197.452 . . 1 . . . . . 329 C N3 . 50351 1 101 . 1 . 1 30 30 C N4 N 15 96.7195 . . 1 . . . . . 329 C N4 . 50351 1 102 . 1 . 1 31 31 A H1' H 1 5.9925 . . 1 . . . . . 330 A H1' . 50351 1 103 . 1 . 1 31 31 A H2 H 1 7.06614 . . 1 . . . . . 330 A H2 . 50351 1 104 . 1 . 1 31 31 A H8 H 1 8.018 . . 1 . . . . . 330 A H8 . 50351 1 105 . 1 . 1 31 31 A N1 N 15 220.261 . . 1 . . . . . 330 A N1 . 50351 1 106 . 1 . 1 31 31 A N3 N 15 213.58 . . 1 . . . . . 330 A N3 . 50351 1 107 . 1 . 1 32 32 G H1 H 1 12.9202 . . 1 . . . . . 331 G H1 . 50351 1 108 . 1 . 1 32 32 G H1' H 1 5.57983 . . 1 . . . . . 331 G H1' . 50351 1 109 . 1 . 1 32 32 G H8 H 1 7.14 . . 1 . . . . . 331 G H8 . 50351 1 110 . 1 . 1 32 32 G C1' C 13 92.511 . . 1 . . . . . 331 G C1' . 50351 1 111 . 1 . 1 32 32 G C8 C 13 135.579 . . 1 . . . . . 331 G C8 . 50351 1 112 . 1 . 1 32 32 G N1 N 15 147.358 . . 1 . . . . . 331 G N1 . 50351 1 113 . 1 . 1 32 32 G N9 N 15 169.118 . . 1 . . . . . 331 G N9 . 50351 1 114 . 1 . 1 33 33 G H1 H 1 13.4465 . . 1 . . . . . 332 G H1 . 50351 1 115 . 1 . 1 33 33 G H1' H 1 5.71 . . 1 . . . . . 332 G H1' . 50351 1 116 . 1 . 1 33 33 G H8 H 1 7.065 . . 1 . . . . . 332 G H8 . 50351 1 117 . 1 . 1 33 33 G C1' C 13 93.177 . . 1 . . . . . 332 G C1' . 50351 1 118 . 1 . 1 33 33 G C8 C 13 135.721 . . 1 . . . . . 332 G C8 . 50351 1 119 . 1 . 1 33 33 G N1 N 15 148.681 . . 1 . . . . . 332 G N1 . 50351 1 120 . 1 . 1 33 33 G N9 N 15 169.45 . . 1 . . . . . 332 G N9 . 50351 1 121 . 1 . 1 34 34 U H1' H 1 5.6495 . . 1 . . . . . 333 U H1' . 50351 1 122 . 1 . 1 34 34 U H3 H 1 12.0985 . . 1 . . . . . 333 U H3 . 50351 1 123 . 1 . 1 34 34 U H5 H 1 5.3588 . . 1 . . . . . 333 U H5 . 50351 1 124 . 1 . 1 34 34 U H6 H 1 7.603 . . 1 . . . . . 333 U H6 . 50351 1 125 . 1 . 1 34 34 U C1' C 13 93.33 . . 1 . . . . . 333 U C1' . 50351 1 126 . 1 . 1 34 34 U C5 C 13 104.169 . . 1 . . . . . 333 U C5 . 50351 1 127 . 1 . 1 34 34 U C6 C 13 140.716 . . 1 . . . . . 333 U C6 . 50351 1 128 . 1 . 1 34 34 U N1 N 15 145.793 . . 1 . . . . . 333 U N1 . 50351 1 129 . 1 . 1 34 34 U N3 N 15 158.882 . . 1 . . . . . 333 U N3 . 50351 1 130 . 1 . 1 39 39 G H1 H 1 12.4016 . . 1 . . . . . 338 G H1 . 50351 1 131 . 1 . 1 39 39 G H8 H 1 7.521 . . 1 . . . . . 338 G H8 . 50351 1 132 . 1 . 1 39 39 G C8 C 13 137.277 . . 1 . . . . . 338 G C8 . 50351 1 133 . 1 . 1 39 39 G N1 N 15 147.108 . . 1 . . . . . 338 G N1 . 50351 1 134 . 1 . 1 40 40 A H1' H 1 6.0092 . . 1 . . . . . 339 A H1' . 50351 1 135 . 1 . 1 40 40 A H2 H 1 7.756 . . 1 . . . . . 339 A H2 . 50351 1 136 . 1 . 1 40 40 A N1 N 15 222.646 . . 1 . . . . . 339 A N1 . 50351 1 137 . 1 . 1 40 40 A N3 N 15 212.288 . . 1 . . . . . 339 A N3 . 50351 1 138 . 1 . 1 41 41 C H1' H 1 5.3925 . . 1 . . . . . 340 C H1' . 50351 1 139 . 1 . 1 41 41 C H5 H 1 5.24933 . . 1 . . . . . 340 C H5 . 50351 1 140 . 1 . 1 41 41 C H6 H 1 7.3685 . . 1 . . . . . 340 C H6 . 50351 1 141 . 1 . 1 41 41 C H41 H 1 8.2575 . . 1 . . . . . 340 C H41 . 50351 1 142 . 1 . 1 41 41 C H42 H 1 6.84533 . . 1 . . . . . 340 C H42 . 50351 1 143 . 1 . 1 41 41 C N3 N 15 197.156 . . 1 . . . . . 340 C N3 . 50351 1 144 . 1 . 1 41 41 C N4 N 15 98.209 . . 1 . . . . . 340 C N4 . 50351 1 145 . 1 . 1 42 42 G H1 H 1 12.8978 . . 1 . . . . . 341 G H1 . 50351 1 146 . 1 . 1 42 42 G H1' H 1 5.72075 . . 1 . . . . . 341 G H1' . 50351 1 147 . 1 . 1 42 42 G H8 H 1 7.51075 . . 1 . . . . . 341 G H8 . 50351 1 148 . 1 . 1 42 42 G C1' C 13 93.145 . . 1 . . . . . 341 G C1' . 50351 1 149 . 1 . 1 42 42 G C8 C 13 136.283 . . 1 . . . . . 341 G C8 . 50351 1 150 . 1 . 1 42 42 G N1 N 15 147.524 . . 1 . . . . . 341 G N1 . 50351 1 151 . 1 . 1 42 42 G N9 N 15 168.937 . . 1 . . . . . 341 G N9 . 50351 1 152 . 1 . 1 43 43 U H1' H 1 5.5375 . . 1 . . . . . 342 U H1' . 50351 1 153 . 1 . 1 43 43 U H3 H 1 13.6288 . . 1 . . . . . 342 U H3 . 50351 1 154 . 1 . 1 43 43 U H5 H 1 5.0765 . . 1 . . . . . 342 U H5 . 50351 1 155 . 1 . 1 43 43 U H6 H 1 7.7408 . . 1 . . . . . 342 U H6 . 50351 1 156 . 1 . 1 43 43 U C1' C 13 93.519 . . 1 . . . . . 342 U C1' . 50351 1 157 . 1 . 1 43 43 U C5 C 13 103 . . 1 . . . . . 342 U C5 . 50351 1 158 . 1 . 1 43 43 U C6 C 13 141.239 . . 1 . . . . . 342 U C6 . 50351 1 159 . 1 . 1 43 43 U N1 N 15 145.666 . . 1 . . . . . 342 U N1 . 50351 1 160 . 1 . 1 43 43 U N3 N 15 162.112 . . 1 . . . . . 342 U N3 . 50351 1 161 . 1 . 1 44 44 G H1 H 1 12.5891 . . 1 . . . . . 343 G H1 . 50351 1 162 . 1 . 1 44 44 G H1' H 1 5.79917 . . 1 . . . . . 343 G H1' . 50351 1 163 . 1 . 1 44 44 G H8 H 1 7.7128 . . 1 . . . . . 343 G H8 . 50351 1 164 . 1 . 1 44 44 G C1' C 13 92.907 . . 1 . . . . . 343 G C1' . 50351 1 165 . 1 . 1 44 44 G C8 C 13 136.105 . . 1 . . . . . 343 G C8 . 50351 1 166 . 1 . 1 44 44 G N1 N 15 147.914 . . 1 . . . . . 343 G N1 . 50351 1 167 . 1 . 1 44 44 G N9 N 15 169.439 . . 1 . . . . . 343 G N9 . 50351 1 168 . 1 . 1 45 45 C H1' H 1 5.479 . . 1 . . . . . 1 C H1' . 50351 1 169 . 1 . 1 45 45 C H5 H 1 5.23667 . . 1 . . . . . 1 C H5 . 50351 1 170 . 1 . 1 45 45 C H6 H 1 7.64871 . . 1 . . . . . 1 C H6 . 50351 1 171 . 1 . 1 45 45 C H41 H 1 8.5065 . . 1 . . . . . 1 C H41 . 50351 1 172 . 1 . 1 45 45 C H42 H 1 6.87433 . . 1 . . . . . 1 C H42 . 50351 1 173 . 1 . 1 45 45 C N3 N 15 198.255 . . 1 . . . . . 1 C N3 . 50351 1 174 . 1 . 1 45 45 C N4 N 15 99.1672 . . 1 . . . . . 1 C N4 . 50351 1 175 . 1 . 1 46 46 C H1' H 1 6.105 . . 1 . . . . . 2 C H1' . 50351 1 176 . 1 . 1 46 46 C H3' H 1 4.947 . . 1 . . . . . 2 C H3' . 50351 1 177 . 1 . 1 46 46 C H5 H 1 5.546 . . 1 . . . . . 2 C H5 . 50351 1 178 . 1 . 1 46 46 C H6 H 1 7.47582 . . 1 . . . . . 2 C H6 . 50351 1 179 . 1 . 1 46 46 C H41 H 1 8.518 . . 1 . . . . . 2 C H41 . 50351 1 180 . 1 . 1 46 46 C H42 H 1 7.06175 . . 1 . . . . . 2 C H42 . 50351 1 181 . 1 . 1 46 46 C N4 N 15 99.2467 . . 1 . . . . . 2 C N4 . 50351 1 stop_ save_