data_5528 ####################### # Entry information # ####################### save_entry_information _Entry.Sf_category entry_information _Entry.Sf_framecode entry_information _Entry.ID 5528 _Entry.Title ; Solution structure of the complementary RNA promoter of influenza a virus ; _Entry.Type macromolecule _Entry.Version_type original _Entry.Submission_date 2002-09-13 _Entry.Accession_date 2002-09-13 _Entry.Last_release_date 2003-07-07 _Entry.Original_release_date 2003-07-07 _Entry.Origination author _Entry.NMR_STAR_version 3.1.1.61 _Entry.Original_NMR_STAR_version 2.1 _Entry.Experimental_method NMR _Entry.Experimental_method_subtype . _Entry.Details . _Entry.BMRB_internal_directory_name . loop_ _Entry_author.Ordinal _Entry_author.Given_name _Entry_author.Family_name _Entry_author.First_initial _Entry_author.Middle_initials _Entry_author.Family_title _Entry_author.Entry_ID 1 C.-J. Park . . . 5528 2 S.-H. Bae . . . 5528 3 G. Varani . . . 5528 4 M.-K. Lee . . . 5528 5 B.-S. Choi . . . 5528 stop_ loop_ _Data_set.Type _Data_set.Count _Data_set.Entry_ID assigned_chemical_shifts 1 5528 stop_ loop_ _Datum.Type _Datum.Count _Datum.Entry_ID '31P chemical shifts' 13 5528 stop_ loop_ _Release.Release_number _Release.Format_type _Release.Format_version _Release.Date _Release.Submission_date _Release.Type _Release.Author _Release.Detail _Release.Entry_ID 1 . . 2003-07-07 2002-09-13 original author . 5528 stop_ loop_ _Related_entries.Database_name _Related_entries.Database_accession_code _Related_entries.Relationship _Related_entries.Entry_ID PDB 1M82 'BMRB Entry Tracking System' 5528 stop_ save_ ############### # Citations # ############### save_entry_citation _Citation.Sf_category citations _Citation.Sf_framecode entry_citation _Citation.Entry_ID 5528 _Citation.ID 1 _Citation.Class 'entry citation' _Citation.CAS_abstract_code . _Citation.MEDLINE_UI_code 22656697 _Citation.DOI . _Citation.PubMed_ID 12771209 _Citation.Full_citation . _Citation.Title ; Solution Structure of the Influenza A Virus cRNA Promoter: Implications for Differential Recognition of Viral Promoter Structures by RNA-dependent RNA Polymerase ; _Citation.Status published _Citation.Type journal _Citation.Journal_abbrev 'Nucleic Acids Res.' _Citation.Journal_name_full . _Citation.Journal_volume 31 _Citation.Journal_issue 11 _Citation.Journal_ASTM . _Citation.Journal_ISSN . _Citation.Journal_CSD . _Citation.Book_title . _Citation.Book_chapter_title . _Citation.Book_volume . _Citation.Book_series . _Citation.Book_publisher . _Citation.Book_publisher_city . _Citation.Book_ISBN . _Citation.Conference_title . _Citation.Conference_site . _Citation.Conference_state_province . _Citation.Conference_country . _Citation.Conference_start_date . _Citation.Conference_end_date . _Citation.Conference_abstract_number . _Citation.Thesis_institution . _Citation.Thesis_institution_city . _Citation.Thesis_institution_country . _Citation.WWW_URL . _Citation.Page_first 2824 _Citation.Page_last 2832 _Citation.Year 2003 _Citation.Details . loop_ _Citation_author.Ordinal _Citation_author.Given_name _Citation_author.Family_name _Citation_author.First_initial _Citation_author.Middle_initials _Citation_author.Family_title _Citation_author.Entry_ID _Citation_author.Citation_ID 1 C.-J. Park . . . 5528 1 2 S.-H. Bae . . . 5528 1 3 M.-K. Lee . . . 5528 1 4 G. Varani . . . 5528 1 5 B.-S. Choi . . . 5528 1 stop_ loop_ _Citation_keyword.Keyword _Citation_keyword.Entry_ID _Citation_keyword.Citation_ID 'A-form helix' 5528 1 'asymmetric internal loop' 5528 1 stop_ save_ ############################################# # Molecular system (assembly) description # ############################################# save_system_cRNA_promoter _Assembly.Sf_category assembly _Assembly.Sf_framecode system_cRNA_promoter _Assembly.Entry_ID 5528 _Assembly.ID 1 _Assembly.Name 'RNA (25-MER):the complementary RNA promoter of influenza a virus' _Assembly.BMRB_code . _Assembly.Number_of_components . _Assembly.Organic_ligands . _Assembly.Metal_ions . _Assembly.Non_standard_bonds . _Assembly.Ambiguous_conformational_states . _Assembly.Ambiguous_chem_comp_sites . _Assembly.Molecules_in_chemical_exchange . _Assembly.Paramagnetic no _Assembly.Thiol_state 'not present' _Assembly.Molecular_mass . _Assembly.Enzyme_commission_number . _Assembly.Details . _Assembly.DB_query_date . _Assembly.DB_query_revised_last_date . loop_ _Assembly_type.Type _Assembly_type.Entry_ID _Assembly_type.Assembly_ID monomer 5528 1 stop_ loop_ _Entity_assembly.ID _Entity_assembly.Entity_assembly_name _Entity_assembly.Entity_ID _Entity_assembly.Entity_label _Entity_assembly.Asym_ID _Entity_assembly.PDB_chain_ID _Entity_assembly.Experimental_data_reported _Entity_assembly.Physical_state _Entity_assembly.Conformational_isomer _Entity_assembly.Chemical_exchange_state _Entity_assembly.Magnetic_equivalence_group_code _Entity_assembly.Role _Entity_assembly.Details _Entity_assembly.Entry_ID _Entity_assembly.Assembly_ID 1 'complementary RNA promoter' 1 $cRNA_promoter . . . native . . . . . 5528 1 stop_ loop_ _Assembly_db_link.Author_supplied _Assembly_db_link.Database_code _Assembly_db_link.Accession_code _Assembly_db_link.Entry_mol_code _Assembly_db_link.Entry_mol_name _Assembly_db_link.Entry_experimental_method _Assembly_db_link.Entry_structure_resolution _Assembly_db_link.Entry_relation_type _Assembly_db_link.Entry_details _Assembly_db_link.Entry_ID _Assembly_db_link.Assembly_ID . PDB 1M82 . . . . . . 5528 1 stop_ loop_ _Assembly_common_name.Name _Assembly_common_name.Type _Assembly_common_name.Entry_ID _Assembly_common_name.Assembly_ID 'cRNA promoter of influenza virus' abbreviation 5528 1 'RNA (25-MER):the complementary RNA promoter of influenza a virus' system 5528 1 stop_ save_ #################################### # Biological polymers and ligands # #################################### save_cRNA_promoter _Entity.Sf_category entity _Entity.Sf_framecode cRNA_promoter _Entity.Entry_ID 5528 _Entity.ID 1 _Entity.BMRB_code . _Entity.Name 'complementary RNA promoter of influenza virus' _Entity.Type polymer _Entity.Polymer_common_type . _Entity.Polymer_type polyribonucleotide _Entity.Polymer_type_details . _Entity.Polymer_strand_ID . _Entity.Polymer_seq_one_letter_code_can . _Entity.Polymer_seq_one_letter_code ; GGAAGCAGGCUUCGGCCUUG UUUCC ; _Entity.Target_identifier . _Entity.Polymer_author_defined_seq . _Entity.Polymer_author_seq_details . _Entity.Ambiguous_conformational_states . _Entity.Ambiguous_chem_comp_sites . _Entity.Nstd_monomer . _Entity.Nstd_chirality . _Entity.Nstd_linkage . _Entity.Nonpolymer_comp_ID . _Entity.Nonpolymer_comp_label . _Entity.Number_of_monomers 25 _Entity.Number_of_nonpolymer_components . _Entity.Paramagnetic . _Entity.Thiol_state 'not present' _Entity.Src_method . _Entity.Parent_entity_ID . _Entity.Fragment . _Entity.Mutation . _Entity.EC_number . _Entity.Calc_isoelectric_point . _Entity.Formula_weight . _Entity.Formula_weight_exptl . _Entity.Formula_weight_exptl_meth . _Entity.Details . _Entity.DB_query_date . _Entity.DB_query_revised_last_date . loop_ _Entity_common_name.Name _Entity_common_name.Type _Entity_common_name.Entry_ID _Entity_common_name.Entity_ID 'complementary RNA promoter of influenza virus' common 5528 1 'cRNA promoter' abbreviation 5528 1 stop_ loop_ _Entity_comp_index.ID _Entity_comp_index.Auth_seq_ID _Entity_comp_index.Comp_ID _Entity_comp_index.Comp_label _Entity_comp_index.Entry_ID _Entity_comp_index.Entity_ID 1 . G . 5528 1 2 . G . 5528 1 3 . A . 5528 1 4 . A . 5528 1 5 . G . 5528 1 6 . C . 5528 1 7 . A . 5528 1 8 . G . 5528 1 9 . G . 5528 1 10 . C . 5528 1 11 . U . 5528 1 12 . U . 5528 1 13 . C . 5528 1 14 . G . 5528 1 15 . G . 5528 1 16 . C . 5528 1 17 . C . 5528 1 18 . U . 5528 1 19 . U . 5528 1 20 . G . 5528 1 21 . U . 5528 1 22 . U . 5528 1 23 . U . 5528 1 24 . C . 5528 1 25 . C . 5528 1 stop_ loop_ _Entity_poly_seq.Hetero _Entity_poly_seq.Mon_ID _Entity_poly_seq.Num _Entity_poly_seq.Comp_index_ID _Entity_poly_seq.Entry_ID _Entity_poly_seq.Entity_ID . G 1 1 5528 1 . G 2 2 5528 1 . A 3 3 5528 1 . A 4 4 5528 1 . G 5 5 5528 1 . C 6 6 5528 1 . A 7 7 5528 1 . G 8 8 5528 1 . G 9 9 5528 1 . C 10 10 5528 1 . U 11 11 5528 1 . U 12 12 5528 1 . C 13 13 5528 1 . G 14 14 5528 1 . G 15 15 5528 1 . C 16 16 5528 1 . C 17 17 5528 1 . U 18 18 5528 1 . U 19 19 5528 1 . G 20 20 5528 1 . U 21 21 5528 1 . U 22 22 5528 1 . U 23 23 5528 1 . C 24 24 5528 1 . C 25 25 5528 1 stop_ save_ #################### # Natural source # #################### save_natural_source _Entity_natural_src_list.Sf_category natural_source _Entity_natural_src_list.Sf_framecode natural_source _Entity_natural_src_list.Entry_ID 5528 _Entity_natural_src_list.ID 1 loop_ _Entity_natural_src.ID _Entity_natural_src.Entity_ID _Entity_natural_src.Entity_label _Entity_natural_src.Entity_chimera_segment_ID _Entity_natural_src.NCBI_taxonomy_ID _Entity_natural_src.Type _Entity_natural_src.Common _Entity_natural_src.Organism_name_scientific _Entity_natural_src.Organism_name_common _Entity_natural_src.Organism_acronym _Entity_natural_src.ICTVdb_decimal_code _Entity_natural_src.Superkingdom _Entity_natural_src.Kingdom _Entity_natural_src.Genus _Entity_natural_src.Species _Entity_natural_src.Strain _Entity_natural_src.Variant _Entity_natural_src.Subvariant _Entity_natural_src.Organ _Entity_natural_src.Tissue _Entity_natural_src.Tissue_fraction _Entity_natural_src.Cell_line _Entity_natural_src.Cell_type _Entity_natural_src.ATCC_number _Entity_natural_src.Organelle _Entity_natural_src.Cellular_location _Entity_natural_src.Fragment _Entity_natural_src.Fraction _Entity_natural_src.Secretion _Entity_natural_src.Plasmid _Entity_natural_src.Plasmid_details _Entity_natural_src.Gene_mnemonic _Entity_natural_src.Dev_stage _Entity_natural_src.Details _Entity_natural_src.Citation_ID _Entity_natural_src.Citation_label _Entity_natural_src.Entry_ID _Entity_natural_src.Entity_natural_src_list_ID 1 1 $cRNA_promoter . 11320 . . 'influenzavirus A' 'influenza A virus' . . . . 'influenzavirus A' . . . . . . . . . . . . . . . . . . . . . . 5528 1 stop_ save_ ######################### # Experimental source # ######################### save_experimental_source _Entity_experimental_src_list.Sf_category experimental_source _Entity_experimental_src_list.Sf_framecode experimental_source _Entity_experimental_src_list.Entry_ID 5528 _Entity_experimental_src_list.ID 1 loop_ _Entity_experimental_src.ID _Entity_experimental_src.Entity_ID _Entity_experimental_src.Entity_label _Entity_experimental_src.Entity_chimera_segment_ID _Entity_experimental_src.Production_method _Entity_experimental_src.Host_org_scientific_name _Entity_experimental_src.Host_org_name_common _Entity_experimental_src.Host_org_details _Entity_experimental_src.Host_org_NCBI_taxonomy_ID _Entity_experimental_src.Host_org_genus _Entity_experimental_src.Host_org_species _Entity_experimental_src.Host_org_strain _Entity_experimental_src.Host_org_variant _Entity_experimental_src.Host_org_subvariant _Entity_experimental_src.Host_org_organ _Entity_experimental_src.Host_org_tissue _Entity_experimental_src.Host_org_tissue_fraction _Entity_experimental_src.Host_org_cell_line _Entity_experimental_src.Host_org_cell_type _Entity_experimental_src.Host_org_cellular_location _Entity_experimental_src.Host_org_organelle _Entity_experimental_src.Host_org_gene _Entity_experimental_src.Host_org_culture_collection _Entity_experimental_src.Host_org_ATCC_number _Entity_experimental_src.Vector_type _Entity_experimental_src.PDBview_host_org_vector_name _Entity_experimental_src.PDBview_plasmid_name _Entity_experimental_src.Vector_name _Entity_experimental_src.Vector_details _Entity_experimental_src.Vendor_name _Entity_experimental_src.Host_org_dev_stage _Entity_experimental_src.Details _Entity_experimental_src.Citation_ID _Entity_experimental_src.Citation_label _Entity_experimental_src.Entry_ID _Entity_experimental_src.Entity_experimental_src_list_ID 1 1 $cRNA_promoter . 'enzymatic semisynthesis' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5528 1 stop_ save_ ##################################### # Sample contents and methodology # ##################################### ######################## # Sample description # ######################## save_sample_1 _Sample.Sf_category sample _Sample.Sf_framecode sample_1 _Sample.Entry_ID 5528 _Sample.ID 1 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'complementary RNA promoter of influenza virus' . . . 1 $cRNA_promoter . . 1 . . mM . . . . 5528 1 2 'phosphate buffer' . . . . . . . 20 . . mM . . . . 5528 1 3 EDTA . . . . . . . 0.1 . . mM . . . . 5528 1 4 H2O . . . . . . . 90 . . % . . . . 5528 1 5 D2O . . . . . . . 10 . . % . . . . 5528 1 stop_ save_ save_sample_2 _Sample.Sf_category sample _Sample.Sf_framecode sample_2 _Sample.Entry_ID 5528 _Sample.ID 2 _Sample.Type solution _Sample.Sub_type . _Sample.Details . _Sample.Aggregate_sample_number . _Sample.Solvent_system . _Sample.Preparation_date . _Sample.Preparation_expiration_date . _Sample.Polycrystallization_protocol . _Sample.Single_crystal_protocol . _Sample.Crystal_grow_apparatus . _Sample.Crystal_grow_atmosphere . _Sample.Crystal_grow_details . _Sample.Crystal_grow_method . _Sample.Crystal_grow_method_cit_ID . _Sample.Crystal_grow_pH . _Sample.Crystal_grow_pH_range . _Sample.Crystal_grow_pressure . _Sample.Crystal_grow_pressure_esd . _Sample.Crystal_grow_seeding . _Sample.Crystal_grow_seeding_cit_ID . _Sample.Crystal_grow_temp . _Sample.Crystal_grow_temp_details . _Sample.Crystal_grow_temp_esd . _Sample.Crystal_grow_time . _Sample.Oriented_sample_prep_protocol . _Sample.Lyophilization_cryo_protectant . _Sample.Storage_protocol . loop_ _Sample_component.ID _Sample_component.Mol_common_name _Sample_component.Isotopic_labeling _Sample_component.Assembly_ID _Sample_component.Assembly_label _Sample_component.Entity_ID _Sample_component.Entity_label _Sample_component.Product_ID _Sample_component.Type _Sample_component.Concentration_val _Sample_component.Concentration_val_min _Sample_component.Concentration_val_max _Sample_component.Concentration_val_units _Sample_component.Concentration_val_err _Sample_component.Vendor _Sample_component.Vendor_product_name _Sample_component.Vendor_product_code _Sample_component.Entry_ID _Sample_component.Sample_ID 1 'complementary RNA promoter of influenza virus' '[U-15N; U-13C]' . . 1 $cRNA_promoter . . 1 . . mM . . . . 5528 2 2 'phosphate buffer' . . . . . . . 20 . . mM . . . . 5528 2 3 EDTA . . . . . . . 0.1 . . mM . . . . 5528 2 4 D2O . . . . . . . 100 . . % . . . . 5528 2 stop_ save_ ####################### # Sample conditions # ####################### save_sample_cond_1 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_cond_1 _Sample_condition_list.Entry_ID 5528 _Sample_condition_list.ID 1 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 20 . mM 5528 1 pH 6.0 0.1 n/a 5528 1 pressure 1 . atm 5528 1 temperature 300 1 K 5528 1 stop_ save_ save_sample_cond_2 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_cond_2 _Sample_condition_list.Entry_ID 5528 _Sample_condition_list.ID 2 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 20 . mM 5528 2 pH 6.0 0.1 n/a 5528 2 pressure 1 . atm 5528 2 temperature 280 1 K 5528 2 stop_ save_ save_sample_cond_3 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_cond_3 _Sample_condition_list.Entry_ID 5528 _Sample_condition_list.ID 3 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 20 . mM 5528 3 pH 6.0 0.1 n/a 5528 3 pressure 1 . atm 5528 3 temperature 290 1 K 5528 3 stop_ save_ save_sample_cond_4 _Sample_condition_list.Sf_category sample_conditions _Sample_condition_list.Sf_framecode sample_cond_4 _Sample_condition_list.Entry_ID 5528 _Sample_condition_list.ID 4 _Sample_condition_list.Details . loop_ _Sample_condition_variable.Type _Sample_condition_variable.Val _Sample_condition_variable.Val_err _Sample_condition_variable.Val_units _Sample_condition_variable.Entry_ID _Sample_condition_variable.Sample_condition_list_ID 'ionic strength' 20 . mM 5528 4 pH 6.0 0.1 n/a 5528 4 pressure 1 . atm 5528 4 temperature 310 1 K 5528 4 stop_ save_ ############################ # Computer software used # ############################ save_FELIX _Software.Sf_category software _Software.Sf_framecode FELIX _Software.Entry_ID 5528 _Software.ID 1 _Software.Name FELIX _Software.Version 95 _Software.Details 'Biosym, inc.' loop_ _Task.Task _Task.Entry_ID _Task.Software_ID processing 5528 1 stop_ save_ save_VNMR _Software.Sf_category software _Software.Sf_framecode VNMR _Software.Entry_ID 5528 _Software.ID 2 _Software.Name VNMR _Software.Version 6.1c _Software.Details 'Varian, inc.' loop_ _Task.Task _Task.Entry_ID _Task.Software_ID collection 5528 2 stop_ save_ save_CNS _Software.Sf_category software _Software.Sf_framecode CNS _Software.Entry_ID 5528 _Software.ID 3 _Software.Name CNS _Software.Version 1.0 _Software.Details Brunger loop_ _Task.Task _Task.Entry_ID _Task.Software_ID refinement 5528 3 'structure solution' 5528 3 stop_ save_ ######################### # Experimental detail # ######################### ################################## # NMR Spectrometer definitions # ################################## save_NMR_spectrometer _NMR_spectrometer.Sf_category NMR_spectrometer _NMR_spectrometer.Sf_framecode NMR_spectrometer _NMR_spectrometer.Entry_ID 5528 _NMR_spectrometer.ID 1 _NMR_spectrometer.Details . _NMR_spectrometer.Manufacturer Varian _NMR_spectrometer.Model INOVA _NMR_spectrometer.Serial_number . _NMR_spectrometer.Field_strength 600 save_ save_spectrometer_list _NMR_spectrometer_list.Sf_category NMR_spectrometer_list _NMR_spectrometer_list.Sf_framecode spectrometer_list _NMR_spectrometer_list.Entry_ID 5528 _NMR_spectrometer_list.ID 1 loop_ _NMR_spectrometer_view.ID _NMR_spectrometer_view.Name _NMR_spectrometer_view.Manufacturer _NMR_spectrometer_view.Model _NMR_spectrometer_view.Serial_number _NMR_spectrometer_view.Field_strength _NMR_spectrometer_view.Details _NMR_spectrometer_view.Citation_ID _NMR_spectrometer_view.Citation_label _NMR_spectrometer_view.Entry_ID _NMR_spectrometer_view.NMR_spectrometer_list_ID 1 NMR_spectrometer Varian INOVA . 600 . . . 5528 1 stop_ save_ ############################# # NMR applied experiments # ############################# save_experiment_list _Experiment_list.Sf_category experiment_list _Experiment_list.Sf_framecode experiment_list _Experiment_list.Entry_ID 5528 _Experiment_list.ID 1 _Experiment_list.Details . loop_ _Experiment.ID _Experiment.Name _Experiment.Raw_data_flag _Experiment.NMR_spec_expt_ID _Experiment.NMR_spec_expt_label _Experiment.MS_expt_ID _Experiment.MS_expt_label _Experiment.SAXS_expt_ID _Experiment.SAXS_expt_label _Experiment.FRET_expt_ID _Experiment.FRET_expt_label _Experiment.EMR_expt_ID _Experiment.EMR_expt_label _Experiment.Sample_ID _Experiment.Sample_label _Experiment.Sample_state _Experiment.Sample_volume _Experiment.Sample_volume_units _Experiment.Sample_condition_list_ID _Experiment.Sample_condition_list_label _Experiment.Sample_spinning_rate _Experiment.Sample_angle _Experiment.NMR_tube_type _Experiment.NMR_spectrometer_ID _Experiment.NMR_spectrometer_label _Experiment.NMR_spectrometer_probe_ID _Experiment.NMR_spectrometer_probe_label _Experiment.NMR_spectral_processing_ID _Experiment.NMR_spectral_processing_label _Experiment.Mass_spectrometer_ID _Experiment.Mass_spectrometer_label _Experiment.Xray_instrument_ID _Experiment.Xray_instrument_label _Experiment.Fluorescence_instrument_ID _Experiment.Fluorescence_instrument_label _Experiment.EMR_instrument_ID _Experiment.EMR_instrument_label _Experiment.Chromatographic_system_ID _Experiment.Chromatographic_system_label _Experiment.Chromatographic_column_ID _Experiment.Chromatographic_column_label _Experiment.Entry_ID _Experiment.Experiment_list_ID 1 '2D NOESY' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5528 1 2 '2D TOCSY' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5528 1 3 DQF-COSY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5528 1 4 HETCOR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5528 1 5 '3D 13C NOESY-HSQC' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5528 1 6 '3D HCCH-COSY' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5528 1 7 '3D HCCH-COSY-TOCSY' . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5528 1 stop_ save_ save_NMR_spec_expt__0_1 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_1 _NMR_spec_expt.Entry_ID 5528 _NMR_spec_expt.ID 1 _NMR_spec_expt.Name '2D NOESY' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_2 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_2 _NMR_spec_expt.Entry_ID 5528 _NMR_spec_expt.ID 2 _NMR_spec_expt.Name '2D TOCSY' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_3 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_3 _NMR_spec_expt.Entry_ID 5528 _NMR_spec_expt.ID 3 _NMR_spec_expt.Name DQF-COSY _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_4 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_4 _NMR_spec_expt.Entry_ID 5528 _NMR_spec_expt.ID 4 _NMR_spec_expt.Name HETCOR _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_5 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_5 _NMR_spec_expt.Entry_ID 5528 _NMR_spec_expt.ID 5 _NMR_spec_expt.Name '3D 13C NOESY-HSQC' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_6 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_6 _NMR_spec_expt.Entry_ID 5528 _NMR_spec_expt.ID 6 _NMR_spec_expt.Name '3D HCCH-COSY' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ save_NMR_spec_expt__0_7 _NMR_spec_expt.Sf_category NMR_spectrometer_expt _NMR_spec_expt.Sf_framecode NMR_spec_expt__0_7 _NMR_spec_expt.Entry_ID 5528 _NMR_spec_expt.ID 7 _NMR_spec_expt.Name '3D HCCH-COSY-TOCSY' _NMR_spec_expt.Type . _NMR_spec_expt.Sample_volume . _NMR_spec_expt.Sample_volume_units . _NMR_spec_expt.NMR_tube_type . _NMR_spec_expt.Sample_spinning_rate . _NMR_spec_expt.Sample_angle . _NMR_spec_expt.NMR_spectrometer_ID . _NMR_spec_expt.NMR_spectrometer_label . _NMR_spec_expt.NMR_spectrometer_probe_ID . _NMR_spec_expt.NMR_spectrometer_probe_label . _NMR_spec_expt.Carrier_freq_switch_time . _NMR_spec_expt.Software_ID . _NMR_spec_expt.Software_label . _NMR_spec_expt.Method_ID . _NMR_spec_expt.Method_label . _NMR_spec_expt.Pulse_seq_accession_BMRB_code . _NMR_spec_expt.Details . save_ #################### # NMR parameters # #################### ############################## # Assigned chemical shifts # ############################## ################################ # Chemical shift referencing # ################################ save_chemical_shift_reference _Chem_shift_reference.Sf_category chem_shift_reference _Chem_shift_reference.Sf_framecode chemical_shift_reference _Chem_shift_reference.Entry_ID 5528 _Chem_shift_reference.ID 1 _Chem_shift_reference.Details . loop_ _Chem_shift_ref.Atom_type _Chem_shift_ref.Atom_isotope_number _Chem_shift_ref.Mol_common_name _Chem_shift_ref.Atom_group _Chem_shift_ref.Concentration_val _Chem_shift_ref.Concentration_units _Chem_shift_ref.Solvent _Chem_shift_ref.Rank _Chem_shift_ref.Chem_shift_units _Chem_shift_ref.Chem_shift_val _Chem_shift_ref.Ref_method _Chem_shift_ref.Ref_type _Chem_shift_ref.Indirect_shift_ratio _Chem_shift_ref.External_ref_loc _Chem_shift_ref.External_ref_sample_geometry _Chem_shift_ref.External_ref_axis _Chem_shift_ref.Indirect_shift_ratio_cit_ID _Chem_shift_ref.Indirect_shift_ratio_cit_label _Chem_shift_ref.Ref_correction_type _Chem_shift_ref.Correction_val _Chem_shift_ref.Correction_val_cit_ID _Chem_shift_ref.Correction_val_cit_label _Chem_shift_ref.Entry_ID _Chem_shift_ref.Chem_shift_reference_ID H 1 DSS 'methyl protons' . . . . ppm 0.0 internal direct 1.0 . . . . . . . . . 5528 1 P 31 DSS 'methyl protons' . . . . ppm 0.0 . indirect 0.404808636 . . . . . . . . . 5528 1 stop_ save_ ################################### # Assigned chemical shift lists # ################################### ################################################################### # Chemical Shift Ambiguity Index Value Definitions # # # # The values other than 1 are used for those atoms with different # # chemical shifts that cannot be assigned to stereospecific atoms # # or to specific residues or chains. # # # # Index Value Definition # # # # 1 Unique (including isolated methyl protons, # # geminal atoms, and geminal methyl # # groups with identical chemical shifts) # # (e.g. ILE HD11, HD12, HD13 protons) # # 2 Ambiguity of geminal atoms or geminal methyl # # proton groups (e.g. ASP HB2 and HB3 # # protons, LEU CD1 and CD2 carbons, or # # LEU HD11, HD12, HD13 and HD21, HD22, # # HD23 methyl protons) # # 3 Aromatic atoms on opposite sides of # # symmetrical rings (e.g. TYR HE1 and HE2 # # protons) # # 4 Intraresidue ambiguities (e.g. LYS HG and # # HD protons or TRP HZ2 and HZ3 protons) # # 5 Interresidue ambiguities (LYS 12 vs. LYS 27) # # 6 Intermolecular ambiguities (e.g. ASP 31 CA # # in monomer 1 and ASP 31 CA in monomer 2 # # of an asymmetrical homodimer, duplex # # DNA assignments, or other assignments # # that may apply to atoms in one or more # # molecule in the molecular assembly) # # 9 Ambiguous, specific ambiguity not defined # # # ################################################################### save_chemical_shift_set_1 _Assigned_chem_shift_list.Sf_category assigned_chemical_shifts _Assigned_chem_shift_list.Sf_framecode chemical_shift_set_1 _Assigned_chem_shift_list.Entry_ID 5528 _Assigned_chem_shift_list.ID 1 _Assigned_chem_shift_list.Sample_condition_list_ID 1 _Assigned_chem_shift_list.Sample_condition_list_label $sample_cond_1 _Assigned_chem_shift_list.Chem_shift_reference_ID 1 _Assigned_chem_shift_list.Chem_shift_reference_label $chemical_shift_reference _Assigned_chem_shift_list.Chem_shift_1H_err . _Assigned_chem_shift_list.Chem_shift_13C_err . _Assigned_chem_shift_list.Chem_shift_15N_err . _Assigned_chem_shift_list.Chem_shift_31P_err . _Assigned_chem_shift_list.Chem_shift_2H_err . _Assigned_chem_shift_list.Chem_shift_19F_err . _Assigned_chem_shift_list.Error_derivation_method . _Assigned_chem_shift_list.Details . _Assigned_chem_shift_list.Text_data_format . _Assigned_chem_shift_list.Text_data . loop_ _Chem_shift_experiment.Experiment_ID _Chem_shift_experiment.Experiment_name _Chem_shift_experiment.Sample_ID _Chem_shift_experiment.Sample_label _Chem_shift_experiment.Sample_state _Chem_shift_experiment.Entry_ID _Chem_shift_experiment.Assigned_chem_shift_list_ID . . 1 $sample_1 . 5528 1 . . 2 $sample_2 . 5528 1 stop_ loop_ _Atom_chem_shift.ID _Atom_chem_shift.Assembly_atom_ID _Atom_chem_shift.Entity_assembly_ID _Atom_chem_shift.Entity_ID _Atom_chem_shift.Comp_index_ID _Atom_chem_shift.Seq_ID _Atom_chem_shift.Comp_ID _Atom_chem_shift.Atom_ID _Atom_chem_shift.Atom_type _Atom_chem_shift.Atom_isotope_number _Atom_chem_shift.Val _Atom_chem_shift.Val_err _Atom_chem_shift.Assign_fig_of_merit _Atom_chem_shift.Ambiguity_code _Atom_chem_shift.Occupancy _Atom_chem_shift.Resonance_ID _Atom_chem_shift.Auth_entity_assembly_ID _Atom_chem_shift.Auth_asym_ID _Atom_chem_shift.Auth_seq_ID _Atom_chem_shift.Auth_comp_ID _Atom_chem_shift.Auth_atom_ID _Atom_chem_shift.Details _Atom_chem_shift.Entry_ID _Atom_chem_shift.Assigned_chem_shift_list_ID 1 . 1 1 1 1 G H8 H 1 8.13 . . 1 . . . . . . . . 5528 1 2 . 1 1 1 1 G H1' H 1 5.82 . . 1 . . . . . . . . 5528 1 3 . 1 1 1 1 G H2' H 1 4.92 . . 1 . . . . . . . . 5528 1 4 . 1 1 1 1 G H3' H 1 4.68 . . 1 . . . . . . . . 5528 1 5 . 1 1 1 1 G H4' H 1 4.54 . . 1 . . . . . . . . 5528 1 6 . 1 1 1 1 G H5' H 1 4.45 . . 1 . . . . . . . . 5528 1 7 . 1 1 1 1 G H5'' H 1 4.27 . . 1 . . . . . . . . 5528 1 8 . 1 1 2 2 G H1 H 1 12.42 . . 1 . . . . . . . . 5528 1 9 . 1 1 2 2 G H21 H 1 8.02 . . 1 . . . . . . . . 5528 1 10 . 1 1 2 2 G H22 H 1 5.93 . . 1 . . . . . . . . 5528 1 11 . 1 1 2 2 G H8 H 1 7.49 . . 1 . . . . . . . . 5528 1 12 . 1 1 2 2 G H1' H 1 5.89 . . 1 . . . . . . . . 5528 1 13 . 1 1 2 2 G H2' H 1 4.65 . . 1 . . . . . . . . 5528 1 14 . 1 1 2 2 G H3' H 1 4.58 . . 1 . . . . . . . . 5528 1 15 . 1 1 2 2 G H4' H 1 4.43 . . 1 . . . . . . . . 5528 1 16 . 1 1 2 2 G H5'' H 1 4.22 . . 1 . . . . . . . . 5528 1 17 . 1 1 3 3 A H2 H 1 7.15 . . 1 . . . . . . . . 5528 1 18 . 1 1 3 3 A H61 H 1 7.92 . . 1 . . . . . . . . 5528 1 19 . 1 1 3 3 A H62 H 1 6.72 . . 1 . . . . . . . . 5528 1 20 . 1 1 3 3 A H8 H 1 7.73 . . 1 . . . . . . . . 5528 1 21 . 1 1 3 3 A H1' H 1 5.93 . . 1 . . . . . . . . 5528 1 22 . 1 1 3 3 A H2' H 1 4.56 . . 1 . . . . . . . . 5528 1 23 . 1 1 3 3 A H3' H 1 4.68 . . 1 . . . . . . . . 5528 1 24 . 1 1 3 3 A H4' H 1 4.51 . . 1 . . . . . . . . 5528 1 25 . 1 1 3 3 A H5'' H 1 4.15 . . 1 . . . . . . . . 5528 1 26 . 1 1 4 4 A H2 H 1 7.41 . . 1 . . . . . . . . 5528 1 27 . 1 1 4 4 A H61 H 1 8.03 . . 1 . . . . . . . . 5528 1 28 . 1 1 4 4 A H62 H 1 6.71 . . 1 . . . . . . . . 5528 1 29 . 1 1 4 4 A H8 H 1 7.69 . . 1 . . . . . . . . 5528 1 30 . 1 1 4 4 A H1' H 1 5.94 . . 1 . . . . . . . . 5528 1 31 . 1 1 4 4 A H2' H 1 4.56 . . 1 . . . . . . . . 5528 1 32 . 1 1 4 4 A H4' H 1 4.47 . . 1 . . . . . . . . 5528 1 33 . 1 1 4 4 A H5'' H 1 4.11 . . 1 . . . . . . . . 5528 1 34 . 1 1 5 5 G H1 H 1 11.60 . . 1 . . . . . . . . 5528 1 35 . 1 1 5 5 G H21 H 1 6.43 . . 1 . . . . . . . . 5528 1 36 . 1 1 5 5 G H22 H 1 6.43 . . 1 . . . . . . . . 5528 1 37 . 1 1 5 5 G H8 H 1 6.89 . . 1 . . . . . . . . 5528 1 38 . 1 1 5 5 G H1' H 1 5.49 . . 1 . . . . . . . . 5528 1 39 . 1 1 5 5 G H2' H 1 4.55 . . 1 . . . . . . . . 5528 1 40 . 1 1 5 5 G H3' H 1 4.08 . . 1 . . . . . . . . 5528 1 41 . 1 1 5 5 G H4' H 1 4.45 . . 1 . . . . . . . . 5528 1 42 . 1 1 5 5 G H5' H 1 4.30 . . 1 . . . . . . . . 5528 1 43 . 1 1 5 5 G H5'' H 1 3.96 . . 1 . . . . . . . . 5528 1 44 . 1 1 6 6 C H41 H 1 8.08 . . 1 . . . . . . . . 5528 1 45 . 1 1 6 6 C H42 H 1 6.97 . . 1 . . . . . . . . 5528 1 46 . 1 1 6 6 C H5 H 1 5.18 . . 1 . . . . . . . . 5528 1 47 . 1 1 6 6 C H6 H 1 7.49 . . 1 . . . . . . . . 5528 1 48 . 1 1 6 6 C H1' H 1 5.46 . . 1 . . . . . . . . 5528 1 49 . 1 1 6 6 C H2' H 1 4.50 . . 1 . . . . . . . . 5528 1 50 . 1 1 6 6 C H3' H 1 4.08 . . 1 . . . . . . . . 5528 1 51 . 1 1 6 6 C H4' H 1 4.39 . . 1 . . . . . . . . 5528 1 52 . 1 1 6 6 C H5'' H 1 4.07 . . 1 . . . . . . . . 5528 1 53 . 1 1 6 6 C P P 31 -4.32 . . 1 . . . . . . . . 5528 1 54 . 1 1 7 7 A H2 H 1 7.06 . . 1 . . . . . . . . 5528 1 55 . 1 1 7 7 A H8 H 1 7.95 . . 1 . . . . . . . . 5528 1 56 . 1 1 7 7 A H1' H 1 5.97 . . 1 . . . . . . . . 5528 1 57 . 1 1 7 7 A H2' H 1 4.68 . . 1 . . . . . . . . 5528 1 58 . 1 1 7 7 A H3' H 1 4.69 . . 1 . . . . . . . . 5528 1 59 . 1 1 7 7 A H4' H 1 4.47 . . 1 . . . . . . . . 5528 1 60 . 1 1 7 7 A H5' H 1 4.54 . . 1 . . . . . . . . 5528 1 61 . 1 1 7 7 A H5'' H 1 4.14 . . 1 . . . . . . . . 5528 1 62 . 1 1 7 7 A P P 31 -3.76 . . 1 . . . . . . . . 5528 1 63 . 1 1 8 8 G H1 H 1 12.99 . . 1 . . . . . . . . 5528 1 64 . 1 1 8 8 G H21 H 1 8.26 . . 1 . . . . . . . . 5528 1 65 . 1 1 8 8 G H22 H 1 5.98 . . 1 . . . . . . . . 5528 1 66 . 1 1 8 8 G H8 H 1 7.14 . . 1 . . . . . . . . 5528 1 67 . 1 1 8 8 G H1' H 1 5.47 . . 1 . . . . . . . . 5528 1 68 . 1 1 8 8 G H2' H 1 4.41 . . 1 . . . . . . . . 5528 1 69 . 1 1 8 8 G H3' H 1 4.48 . . 1 . . . . . . . . 5528 1 70 . 1 1 8 8 G H4' H 1 4.43 . . 1 . . . . . . . . 5528 1 71 . 1 1 8 8 G H5'' H 1 4.06 . . 1 . . . . . . . . 5528 1 72 . 1 1 9 9 G H1 H 1 13.49 . . 1 . . . . . . . . 5528 1 73 . 1 1 9 9 G H21 H 1 8.60 . . 1 . . . . . . . . 5528 1 74 . 1 1 9 9 G H22 H 1 6.15 . . 1 . . . . . . . . 5528 1 75 . 1 1 9 9 G H8 H 1 7.30 . . 1 . . . . . . . . 5528 1 76 . 1 1 9 9 G H1' H 1 5.73 . . 1 . . . . . . . . 5528 1 77 . 1 1 9 9 G H2' H 1 4.47 . . 1 . . . . . . . . 5528 1 78 . 1 1 9 9 G H3' H 1 4.49 . . 1 . . . . . . . . 5528 1 79 . 1 1 9 9 G H4' H 1 4.42 . . 1 . . . . . . . . 5528 1 80 . 1 1 9 9 G H5'' H 1 4.04 . . 1 . . . . . . . . 5528 1 81 . 1 1 10 10 C H41 H 1 8.63 . . 1 . . . . . . . . 5528 1 82 . 1 1 10 10 C H42 H 1 7.03 . . 1 . . . . . . . . 5528 1 83 . 1 1 10 10 C H5 H 1 5.19 . . 1 . . . . . . . . 5528 1 84 . 1 1 10 10 C H6 H 1 7.41 . . 1 . . . . . . . . 5528 1 85 . 1 1 10 10 C H1' H 1 5.51 . . 1 . . . . . . . . 5528 1 86 . 1 1 10 10 C H2' H 1 4.51 . . 1 . . . . . . . . 5528 1 87 . 1 1 10 10 C H3' H 1 4.22 . . 1 . . . . . . . . 5528 1 88 . 1 1 10 10 C H4' H 1 4.41 . . 1 . . . . . . . . 5528 1 89 . 1 1 10 10 C H5'' H 1 4.01 . . 1 . . . . . . . . 5528 1 90 . 1 1 11 11 U H3 H 1 11.85 . . 1 . . . . . . . . 5528 1 91 . 1 1 11 11 U H5 H 1 5.71 . . 1 . . . . . . . . 5528 1 92 . 1 1 11 11 U H6 H 1 7.77 . . 1 . . . . . . . . 5528 1 93 . 1 1 11 11 U H1' H 1 5.69 . . 1 . . . . . . . . 5528 1 94 . 1 1 11 11 U H2' H 1 3.80 . . 1 . . . . . . . . 5528 1 95 . 1 1 11 11 U H3' H 1 4.51 . . 1 . . . . . . . . 5528 1 96 . 1 1 11 11 U H4' H 1 4.37 . . 1 . . . . . . . . 5528 1 97 . 1 1 11 11 U H5' H 1 4.47 . . 1 . . . . . . . . 5528 1 98 . 1 1 11 11 U H5'' H 1 4.09 . . 1 . . . . . . . . 5528 1 99 . 1 1 11 11 U P P 31 -4.09 . . 1 . . . . . . . . 5528 1 100 . 1 1 12 12 U H3 H 1 11.27 . . 1 . . . . . . . . 5528 1 101 . 1 1 12 12 U H5 H 1 5.86 . . 1 . . . . . . . . 5528 1 102 . 1 1 12 12 U H6 H 1 8.03 . . 1 . . . . . . . . 5528 1 103 . 1 1 12 12 U H1' H 1 6.10 . . 1 . . . . . . . . 5528 1 104 . 1 1 12 12 U H2' H 1 4.67 . . 1 . . . . . . . . 5528 1 105 . 1 1 12 12 U H3' H 1 4.03 . . 1 . . . . . . . . 5528 1 106 . 1 1 12 12 U H4' H 1 4.49 . . 1 . . . . . . . . 5528 1 107 . 1 1 12 12 U H5' H 1 4.23 . . 1 . . . . . . . . 5528 1 108 . 1 1 12 12 U H5'' H 1 4.02 . . 1 . . . . . . . . 5528 1 109 . 1 1 12 12 U P P 31 -3.43 . . 1 . . . . . . . . 5528 1 110 . 1 1 13 13 C H41 H 1 7.17 . . 1 . . . . . . . . 5528 1 111 . 1 1 13 13 C H42 H 1 6.43 . . 1 . . . . . . . . 5528 1 112 . 1 1 13 13 C H5 H 1 6.13 . . 1 . . . . . . . . 5528 1 113 . 1 1 13 13 C H6 H 1 7.69 . . 1 . . . . . . . . 5528 1 114 . 1 1 13 13 C H1' H 1 5.96 . . 1 . . . . . . . . 5528 1 115 . 1 1 13 13 C H2' H 1 4.09 . . 1 . . . . . . . . 5528 1 116 . 1 1 13 13 C H3' H 1 4.48 . . 1 . . . . . . . . 5528 1 117 . 1 1 13 13 C H4' H 1 3.79 . . 1 . . . . . . . . 5528 1 118 . 1 1 13 13 C H5' H 1 3.60 . . 1 . . . . . . . . 5528 1 119 . 1 1 13 13 C H5'' H 1 2.71 . . 1 . . . . . . . . 5528 1 120 . 1 1 13 13 C P P 31 -4.99 . . 1 . . . . . . . . 5528 1 121 . 1 1 14 14 G H1 H 1 9.92 . . 1 . . . . . . . . 5528 1 122 . 1 1 14 14 G H8 H 1 7.85 . . 1 . . . . . . . . 5528 1 123 . 1 1 14 14 G H1' H 1 5.95 . . 1 . . . . . . . . 5528 1 124 . 1 1 14 14 G H2' H 1 4.84 . . 1 . . . . . . . . 5528 1 125 . 1 1 14 14 G H3' H 1 5.61 . . 1 . . . . . . . . 5528 1 126 . 1 1 14 14 G H4' H 1 4.39 . . 1 . . . . . . . . 5528 1 127 . 1 1 14 14 G H5' H 1 4.46 . . 1 . . . . . . . . 5528 1 128 . 1 1 14 14 G H5'' H 1 4.17 . . 1 . . . . . . . . 5528 1 129 . 1 1 14 14 G P P 31 -4.89 . . 1 . . . . . . . . 5528 1 130 . 1 1 15 15 G H1 H 1 13.58 . . 1 . . . . . . . . 5528 1 131 . 1 1 15 15 G H21 H 1 8.98 . . 1 . . . . . . . . 5528 1 132 . 1 1 15 15 G H22 H 1 6.52 . . 1 . . . . . . . . 5528 1 133 . 1 1 15 15 G H8 H 1 8.29 . . 1 . . . . . . . . 5528 1 134 . 1 1 15 15 G H1' H 1 4.44 . . 1 . . . . . . . . 5528 1 135 . 1 1 15 15 G H2' H 1 4.46 . . 1 . . . . . . . . 5528 1 136 . 1 1 15 15 G H3' H 1 4.25 . . 1 . . . . . . . . 5528 1 137 . 1 1 15 15 G H4' H 1 4.40 . . 1 . . . . . . . . 5528 1 138 . 1 1 15 15 G H5' H 1 4.49 . . 1 . . . . . . . . 5528 1 139 . 1 1 15 15 G H5'' H 1 4.27 . . 1 . . . . . . . . 5528 1 140 . 1 1 15 15 G P P 31 -2.42 . . 1 . . . . . . . . 5528 1 141 . 1 1 16 16 C H41 H 1 8.79 . . 1 . . . . . . . . 5528 1 142 . 1 1 16 16 C H42 H 1 7.00 . . 1 . . . . . . . . 5528 1 143 . 1 1 16 16 C H5 H 1 5.29 . . 1 . . . . . . . . 5528 1 144 . 1 1 16 16 C H6 H 1 7.68 . . 1 . . . . . . . . 5528 1 145 . 1 1 16 16 C H1' H 1 5.52 . . 1 . . . . . . . . 5528 1 146 . 1 1 16 16 C H2' H 1 4.45 . . 1 . . . . . . . . 5528 1 147 . 1 1 16 16 C H3' H 1 4.40 . . 1 . . . . . . . . 5528 1 148 . 1 1 16 16 C H4' H 1 4.36 . . 1 . . . . . . . . 5528 1 149 . 1 1 16 16 C H5'' H 1 4.01 . . 1 . . . . . . . . 5528 1 150 . 1 1 16 16 C P P 31 -4.51 . . 1 . . . . . . . . 5528 1 151 . 1 1 17 17 C H41 H 1 8.56 . . 1 . . . . . . . . 5528 1 152 . 1 1 17 17 C H42 H 1 7.00 . . 1 . . . . . . . . 5528 1 153 . 1 1 17 17 C H5 H 1 5.58 . . 1 . . . . . . . . 5528 1 154 . 1 1 17 17 C H6 H 1 7.72 . . 1 . . . . . . . . 5528 1 155 . 1 1 17 17 C H1' H 1 5.64 . . 1 . . . . . . . . 5528 1 156 . 1 1 17 17 C H2' H 1 4.25 . . 1 . . . . . . . . 5528 1 157 . 1 1 17 17 C H3' H 1 4.50 . . 1 . . . . . . . . 5528 1 158 . 1 1 17 17 C H4' H 1 4.40 . . 1 . . . . . . . . 5528 1 159 . 1 1 17 17 C H5'' H 1 4.08 . . 1 . . . . . . . . 5528 1 160 . 1 1 17 17 C P P 31 -4.03 . . 1 . . . . . . . . 5528 1 161 . 1 1 18 18 U H5 H 1 5.58 . . 1 . . . . . . . . 5528 1 162 . 1 1 18 18 U H6 H 1 7.81 . . 1 . . . . . . . . 5528 1 163 . 1 1 18 18 U H1' H 1 5.95 . . 1 . . . . . . . . 5528 1 164 . 1 1 18 18 U H2' H 1 4.38 . . 1 . . . . . . . . 5528 1 165 . 1 1 18 18 U H3' H 1 4.75 . . 1 . . . . . . . . 5528 1 166 . 1 1 18 18 U H4' H 1 4.46 . . 1 . . . . . . . . 5528 1 167 . 1 1 18 18 U H5' H 1 4.40 . . 1 . . . . . . . . 5528 1 168 . 1 1 18 18 U H5'' H 1 4.16 . . 1 . . . . . . . . 5528 1 169 . 1 1 19 19 U H5 H 1 5.81 . . 1 . . . . . . . . 5528 1 170 . 1 1 19 19 U H6 H 1 7.88 . . 1 . . . . . . . . 5528 1 171 . 1 1 19 19 U H1' H 1 5.89 . . 1 . . . . . . . . 5528 1 172 . 1 1 19 19 U H2' H 1 4.56 . . 1 . . . . . . . . 5528 1 173 . 1 1 19 19 U H3' H 1 4.71 . . 1 . . . . . . . . 5528 1 174 . 1 1 19 19 U H4' H 1 4.52 . . 1 . . . . . . . . 5528 1 175 . 1 1 19 19 U H5' H 1 4.32 . . 1 . . . . . . . . 5528 1 176 . 1 1 19 19 U H5'' H 1 4.23 . . 1 . . . . . . . . 5528 1 177 . 1 1 19 19 U P P 31 -3.22 . . 1 . . . . . . . . 5528 1 178 . 1 1 20 20 G H1 H 1 12.62 . . 1 . . . . . . . . 5528 1 179 . 1 1 20 20 G H21 H 1 8.28 . . 1 . . . . . . . . 5528 1 180 . 1 1 20 20 G H22 H 1 6.39 . . 1 . . . . . . . . 5528 1 181 . 1 1 20 20 G H8 H 1 7.87 . . 1 . . . . . . . . 5528 1 182 . 1 1 20 20 G H1' H 1 5.84 . . 1 . . . . . . . . 5528 1 183 . 1 1 20 20 G H2' H 1 4.83 . . 1 . . . . . . . . 5528 1 184 . 1 1 20 20 G H3' H 1 4.35 . . 1 . . . . . . . . 5528 1 185 . 1 1 20 20 G H4' H 1 4.57 . . 1 . . . . . . . . 5528 1 186 . 1 1 20 20 G H5' H 1 4.50 . . 1 . . . . . . . . 5528 1 187 . 1 1 20 20 G H5'' H 1 4.11 . . 1 . . . . . . . . 5528 1 188 . 1 1 20 20 G P P 31 -3.50 . . 1 . . . . . . . . 5528 1 189 . 1 1 21 21 U H3 H 1 11.84 . . 1 . . . . . . . . 5528 1 190 . 1 1 21 21 U H5 H 1 5.40 . . 1 . . . . . . . . 5528 1 191 . 1 1 21 21 U H6 H 1 7.70 . . 1 . . . . . . . . 5528 1 192 . 1 1 21 21 U H1' H 1 5.55 . . 1 . . . . . . . . 5528 1 193 . 1 1 21 21 U H2' H 1 4.18 . . 1 . . . . . . . . 5528 1 194 . 1 1 21 21 U H3' H 1 4.56 . . 1 . . . . . . . . 5528 1 195 . 1 1 21 21 U H4' H 1 4.45 . . 1 . . . . . . . . 5528 1 196 . 1 1 21 21 U H5' H 1 4.50 . . 1 . . . . . . . . 5528 1 197 . 1 1 21 21 U H5'' H 1 4.11 . . 1 . . . . . . . . 5528 1 198 . 1 1 21 21 U P P 31 -4.24 . . 1 . . . . . . . . 5528 1 199 . 1 1 22 22 U H3 H 1 14.15 . . 1 . . . . . . . . 5528 1 200 . 1 1 22 22 U H5 H 1 5.60 . . 1 . . . . . . . . 5528 1 201 . 1 1 22 22 U H6 H 1 8.04 . . 1 . . . . . . . . 5528 1 202 . 1 1 22 22 U H1' H 1 5.61 . . 1 . . . . . . . . 5528 1 203 . 1 1 22 22 U H2' H 1 4.49 . . 1 . . . . . . . . 5528 1 204 . 1 1 22 22 U H3' H 1 4.54 . . 1 . . . . . . . . 5528 1 205 . 1 1 22 22 U H4' H 1 4.47 . . 1 . . . . . . . . 5528 1 206 . 1 1 22 22 U H5'' H 1 4.12 . . 1 . . . . . . . . 5528 1 207 . 1 1 23 23 U H3 H 1 13.83 . . 1 . . . . . . . . 5528 1 208 . 1 1 23 23 U H5 H 1 5.60 . . 1 . . . . . . . . 5528 1 209 . 1 1 23 23 U H6 H 1 8.03 . . 1 . . . . . . . . 5528 1 210 . 1 1 23 23 U H1' H 1 5.63 . . 1 . . . . . . . . 5528 1 211 . 1 1 23 23 U H2' H 1 4.45 . . 1 . . . . . . . . 5528 1 212 . 1 1 23 23 U H3' H 1 4.26 . . 1 . . . . . . . . 5528 1 213 . 1 1 23 23 U H5'' H 1 4.14 . . 1 . . . . . . . . 5528 1 214 . 1 1 24 24 C H41 H 1 8.38 . . 1 . . . . . . . . 5528 1 215 . 1 1 24 24 C H42 H 1 7.02 . . 1 . . . . . . . . 5528 1 216 . 1 1 24 24 C H5 H 1 5.63 . . 1 . . . . . . . . 5528 1 217 . 1 1 24 24 C H6 H 1 7.90 . . 1 . . . . . . . . 5528 1 218 . 1 1 24 24 C H1' H 1 5.53 . . 1 . . . . . . . . 5528 1 219 . 1 1 24 24 C H2' H 1 4.16 . . 1 . . . . . . . . 5528 1 220 . 1 1 24 24 C H3' H 1 4.47 . . 1 . . . . . . . . 5528 1 221 . 1 1 24 24 C H4' H 1 4.39 . . 1 . . . . . . . . 5528 1 222 . 1 1 24 24 C H5'' H 1 4.06 . . 1 . . . . . . . . 5528 1 223 . 1 1 25 25 C H41 H 1 8.26 . . 1 . . . . . . . . 5528 1 224 . 1 1 25 25 C H42 H 1 7.00 . . 1 . . . . . . . . 5528 1 225 . 1 1 25 25 C H5 H 1 5.45 . . 1 . . . . . . . . 5528 1 226 . 1 1 25 25 C H6 H 1 7.63 . . 1 . . . . . . . . 5528 1 227 . 1 1 25 25 C H1' H 1 5.69 . . 1 . . . . . . . . 5528 1 228 . 1 1 25 25 C H2' H 1 3.97 . . 1 . . . . . . . . 5528 1 229 . 1 1 25 25 C H3' H 1 4.14 . . 1 . . . . . . . . 5528 1 230 . 1 1 25 25 C H4' H 1 4.14 . . 1 . . . . . . . . 5528 1 231 . 1 1 25 25 C H5'' H 1 4.01 . . 1 . . . . . . . . 5528 1 232 . 1 1 25 25 C P P 31 -4.12 . . 1 . . . . . . . . 5528 1 stop_ save_