BMRB Entry 15538
Click here to enlarge.
PDB ID: 2jwv
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15538
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of a high affinity anti-NFkB RNA aptamer PubMed: 18160411
Deposition date: 2007-10-25 Original release date: 2007-12-18
Authors: Reiter, Nicholas; Maher, L. James; Butcher, Samuel
Citation: Reiter, Nicholas; Maher, L. James; Butcher, Samuel. "DNA mimicry by a high affinity anti-NF-kB RNA apatamer" Nucleic Acids Res. 36, 1227-1236 (2008).
Assembly members:
RNA, polymer, 29 residues, 132.116 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: recombinant technology Host organism: not applicable
Entity Sequences (FASTA):
RNA: GAUACUUGAAACUGUAAGGU
UGGCGUAUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 193 |
| 15N chemical shifts | 31 |
| 1H chemical shifts | 256 |