BMRB Entry 15745
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR15745
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Solution structure of stem-loop alpha; of the hepatitis B virus post-transcriptional regulatory element PubMed: 18263618
Deposition date: 2008-04-28 Original release date: 2008-09-25
Authors: Ohlenschlager, Oliver; Gorlach, Matthias; Schwalbe, Martin
Citation: Schwalbe, Martin; Ohlenschlager, Oliver; Marchanka, Aliaksandr; Ramachandran, Ramadurai; Hafner, Sabine; Heise, Tilman; Gorlach, Matthias. "Solution structure of stem-loop alpha of the hepatitis B virus post-transcriptional regulatory element" Nucleic Acids Research 36, 1681-1689 (2008).
Assembly members:
RNA, polymer, 22 residues, 7105.313 Da.
Natural source: Common Name: hepatitis B virus Taxonomy ID: 10407 Superkingdom: Virus Kingdom: not available Genus/species: Orthohepadnavirus Hepatitis B virus
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
RNA: GGCUCGCAGCAGGUCUGGAG
UC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 145 |
| 15N chemical shifts | 50 |
| 1H chemical shifts | 195 |