BMRB Entry 17130
Chem Shift validation: AVS_anomalous, AVS_full
BMRB Entry DOI: doi:10.13018/BMR17130
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Zif 268 with 12bp DNA PubMed: 20718505
Deposition date: 2010-08-16 Original release date: 2010-09-24
Authors: Takayama, Yuki; Sahu, Debashish
Citation: Takayama, Yuki; Sahu, Debashish; Iwahara, Junji. "NMR studies of translocation of the Zif268 protein between its target DNA Sites." Biochemistry 49, 7998-8005 (2010).
Assembly members:
zif268, polymer, 90 residues, Formula weight is not available
12bp_DNA, polymer, 24 residues, Formula weight is not available
ZN, non-polymer, 65.409 Da.
Natural source: Common Name: house mouse Taxonomy ID: 10090 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Mus musculus
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
zif268: PERPYACPVESCDRRFSRSD
ELTRHIRIHTGQKPFQCRIC
MRNFSRSDHLTTHIRTHTGE
KPFACDICGRKFARSDERKR
HTKIHLRQKD
12bp_DNA: AGCGTGGGCGTATACGCCCA
CGCA
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 175 |
| 15N chemical shifts | 82 |
| 1H chemical shifts | 82 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | zif268 | 1 |
| 2 | zinc1 | 3 |
| 3 | zinc2 | 3 |
| 4 | zinc3 | 3 |
| 5 | 12bp DNA | 2 |
Entities:
Entity 1, zif268 90 residues - Formula weight is not available
zinc finger domains, amino acids 333-421 from the egr1 sequence (uniprot ID: P08046)
| 1 | PRO | GLU | ARG | PRO | TYR | ALA | CYS | PRO | VAL | GLU | |
| 2 | SER | CYS | ASP | ARG | ARG | PHE | SER | ARG | SER | ASP | |
| 3 | GLU | LEU | THR | ARG | HIS | ILE | ARG | ILE | HIS | THR | |
| 4 | GLY | GLN | LYS | PRO | PHE | GLN | CYS | ARG | ILE | CYS | |
| 5 | MET | ARG | ASN | PHE | SER | ARG | SER | ASP | HIS | LEU | |
| 6 | THR | THR | HIS | ILE | ARG | THR | HIS | THR | GLY | GLU | |
| 7 | LYS | PRO | PHE | ALA | CYS | ASP | ILE | CYS | GLY | ARG | |
| 8 | LYS | PHE | ALA | ARG | SER | ASP | GLU | ARG | LYS | ARG | |
| 9 | HIS | THR | LYS | ILE | HIS | LEU | ARG | GLN | LYS | ASP |
Entity 3, zinc1 - Zn - 65.409 Da.
| 1 | ZN |
Entity 2, 12bp DNA 24 residues - Formula weight is not available
| 1 | DA | DG | DC | DG | DT | DG | DG | DG | DC | DG | ||||
| 2 | DT | DA | DT | DA | DC | DG | DC | DC | DC | DA | ||||
| 3 | DC | DG | DC | DA |
Samples:
sample_1: TRIS 10 mM; potassium chloride 20 mM; zif268, [U-13C; U-15N], 1 mM; 12bp DNA 1.2 mM; H2O 93%; D2O 7%
sample_conditions_1: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 273 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 3D HNCACO | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCO | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCA | sample_1 | isotropic | sample_conditions_1 |
| 3D HN(CO)CA | sample_1 | isotropic | sample_conditions_1 |
| 3D CBCA(CO)NH | sample_1 | isotropic | sample_conditions_1 |
| 3D C(CO)NH | sample_1 | isotropic | sample_conditions_1 |
| 3D H(CACO)NH | sample_1 | isotropic | sample_conditions_1 |
| 15N Edited NOESY-HSQC | sample_1 | isotropic | sample_conditions_1 |
Software:
NMRView, Johnson, One Moon Scientific - chemical shift assignment
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
NMR spectrometers:
- Varian INOVA 600 MHz
- Varian Uniform NMR System 800 MHz
Related Database Links:
| PDB | |
| DBJ | BAC29885 BAC30748 BAE21758 BAE26289 BAE27077 |
| EMBL | CAA36777 CAB46678 CAB60137 CAG31294 CDQ66955 |
| GB | AAA35815 AAA37544 AAA39382 AAA40416 AAA60740 |
| REF | NP_001039340 NP_001074426 NP_001083862 NP_001084566 NP_001090830 |
| SP | A4II20 O73691 O73692 O73693 P08046 |
| TPG | DAA27412 |
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts