BMRB Entry 17682
Click here to enlarge.
PDB ID: 2ldt
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17682
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: The 912-888 alternate conformation for helix 27 of E.coli 16S rRNA PubMed: 21442607
Deposition date: 2011-06-02 Original release date: 2011-09-01
Authors: Spano, Meredith; Walter, Nils
Citation: Spano, Meredith Newby; Walter, Nils. "Solution structure of an alternate conformation of helix27 from Escherichia coli16S rRNA." Biopolymers 95, 653-668 (2011).
Assembly members:
RNA_(31-MER), polymer, 31 residues, 3775.495 Da.
Natural source: Common Name: Escherichia coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis Host organism: Escherichia coli
Entity Sequences (FASTA):
RNA_(31-MER): GGGGAGUACGGCCGCAAGGU
UAAAACUCCCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 39 |
| 15N chemical shifts | 8 |
| 1H chemical shifts | 157 |