BMRB Entry 17941
Click here to enlarge.
PDB ID: 2ljj
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17941
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: the structure of subdomain IV-B from the CVB-3 IRES
Deposition date: 2011-09-15 Original release date: 2012-09-17
Authors: Ihle, Yvonne; Zell, Roland; Goerlach, Matthias
Citation: Ihle, Yvonne. "The Structure of Subdomain IV-B from the CVB-3 IRES" Not known ., .-..
Assembly members:
IV-B_RNA, polymer, 27 residues, 8600.216 Da.
Natural source: Common Name: Coxsackievirus B3 Taxonomy ID: 12072 Superkingdom: Viruses Kingdom: not available Genus/species: Enterovirus Human enterovirus B
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
IV-B_RNA: GGCCUCAGCACUACCCCAGU
GUAGGUC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 179 |
| 15N chemical shifts | 47 |
| 1H chemical shifts | 243 |
| 31P chemical shifts | 2 |