BMRB Entry 19278
Click here to enlarge.
PDB ID: 2m90
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR19278
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] duplex-quadruplex hybrid PubMed: 23794476
Deposition date: 2013-05-30 Original release date: 2013-07-08
Authors: Lim, Kah Wai; Phan, Anh Tuan
Citation: Lim, Kah Wai; Phan, Anh Tuan. "Structural basis of DNA quadruplex-duplex junction formation." Angew. Chem. Int. Ed. Engl. 52, 8566-8569 (2013).
Assembly members:
DNA_(32-MER), polymer, 32 residues, 10118.558 Da.
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(32-MER): GCGCGAAGCATTCGCGGGGA
GGTGGGGAAGGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 266 |