BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30257

Title: Structure of wild type pre-miR21 apical loop   PubMed: 28437065

Deposition date: 2017-02-27 Original release date: 2017-06-08

Authors: Shortridge, M.; Varani, G.

Citation: Shortridge, M.; Walker, M.; Pavelitz, T.; Chen, Y.; Yang, W.; Varani, G.. "A macrocyclic peptide ligand binds the oncogenic microRNA-21 precursor and suppresses Dicer processing."  ACS Chem. Biol. 12, 1611-1620 (2017).

Assembly members:
entity_1, polymer, 31 residues, 9912.896 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGUGUUGACUGUUGAAUCUC AUGGCAACACC

Data sets:
Data typeCount
13C chemical shifts129
1H chemical shifts180

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all