BMRB Entry 30257
Click here to enlarge.
PDB ID: 5uzt
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30257
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structure of wild type pre-miR21 apical loop PubMed: 28437065
Deposition date: 2017-02-27 Original release date: 2017-06-08
Authors: Shortridge, M.; Varani, G.
Citation: Shortridge, M.; Walker, M.; Pavelitz, T.; Chen, Y.; Yang, W.; Varani, G.. "A macrocyclic peptide ligand binds the oncogenic microRNA-21 precursor and suppresses Dicer processing." ACS Chem. Biol. 12, 1611-1620 (2017).
Assembly members:
entity_1, polymer, 31 residues, 9912.896 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGUGUUGACUGUUGAAUCUC
AUGGCAACACC
- assigned_chemical_shifts
Data type | Count |
13C chemical shifts | 129 |
1H chemical shifts | 180 |