BMRB Entry 7377
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR7377
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states PubMed: 19636838
Deposition date: 2007-03-16 Original release date: 2007-08-23
Authors: Arunkumar, Alphonse; Pennella, Mario; Kong, Xiangming; David, Giedroc
Citation: Arunkumar, Alphonse; Pennella, Mario; Kong, Xiangming; Giedroc, David. "Resonance assignments of the metal sensor CzrA in the apo-, Zn2- and DNA-bound (42 kDa) states" Biomol. NMR Assignments 1, 99-101 (2007).
Assembly members:
CzrA_Chain, polymer, 106 residues, 11988.69 Da.
DNA, polymer, 28 residues, Formula weight is not available
Natural source: Common Name: Staphylococcus aureus Taxonomy ID: 1280 Superkingdom: Bacteria Kingdom: not available Genus/species: Staphylococcus aureus
Experimental source: Production method: recombinant technology Host organism: Escherichia coli
Entity Sequences (FASTA):
CzrA_Chain: MAEQYSEINTDTLERVTEIF
KALGDYNRIRIMELLSVSEA
SVGHISHQLNLSQSNVSHQL
KLLKSVHLVKAKRQGQSMIY
SLDDIHVATMLKQAIHHANH
PKESGL
DNA: TAACATATGAACATATGTTC
ATATGTTA
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 360 |
| 15N chemical shifts | 114 |
| 1H chemical shifts | 271 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | czra1 | 1 |
| 2 | czra2 | 1 |
| 3 | DNA1 | 2 |
Entities:
Entity 1, czra1 106 residues - 11988.69 Da.
| 1 | MET | ALA | GLU | GLN | TYR | SER | GLU | ILE | ASN | THR | ||||
| 2 | ASP | THR | LEU | GLU | ARG | VAL | THR | GLU | ILE | PHE | ||||
| 3 | LYS | ALA | LEU | GLY | ASP | TYR | ASN | ARG | ILE | ARG | ||||
| 4 | ILE | MET | GLU | LEU | LEU | SER | VAL | SER | GLU | ALA | ||||
| 5 | SER | VAL | GLY | HIS | ILE | SER | HIS | GLN | LEU | ASN | ||||
| 6 | LEU | SER | GLN | SER | ASN | VAL | SER | HIS | GLN | LEU | ||||
| 7 | LYS | LEU | LEU | LYS | SER | VAL | HIS | LEU | VAL | LYS | ||||
| 8 | ALA | LYS | ARG | GLN | GLY | GLN | SER | MET | ILE | TYR | ||||
| 9 | SER | LEU | ASP | ASP | ILE | HIS | VAL | ALA | THR | MET | ||||
| 10 | LEU | LYS | GLN | ALA | ILE | HIS | HIS | ALA | ASN | HIS | ||||
| 11 | PRO | LYS | GLU | SER | GLY | LEU |
Entity 2, DNA1 28 residues - Formula weight is not available
| 1 | DT | DA | DA | DC | DA | DT | DA | DT | DG | DA | ||||
| 2 | DA | DC | DA | DT | DA | DT | DG | DT | DT | DC | ||||
| 3 | DA | DT | DA | DT | DG | DT | DT | DA |
Samples:
DNACzrA_sample_1: CzrA, [U-100% 13C; U-100% 15N; 80% 2H], 1 ± 0.1 mM; DNA1 – 1.5 mM; MES, [U-100% 2H], 10 ± 0.5 mM; sodium chloride 50 ± 1 mM
DNACzrA_sample_2: CzrA, [U-10% 13C], 1 ± 0.1 mM; DNA1 – 1.5 mM; MES, [U-100% 2H], 10 ± 0.5 mM; sodium chloride 50 ± 1 mM
DNACzrA_sample_3: CzrA, [U-2H; U-15N]; [13C]-Ile,Leu,Val-methyl, 1 ± 0.1 mM; DNA1 – 1.5 mM; MES, [U-100% 2H], 10 ± 0.5 mM; sodium chloride 50 ± 1 mM
DNACzrA_sample_4: CzrA, [U-2H; U-15N]; [13C]-Ile,Leu,Val-methyl; [U-2H]-Leu,Val-methyl, 1 ± 0.1 mM; DNA1 – 1.5 mM; MES, [U-100% 2H], 10 ± 0.5 mM; sodium chloride 50 ± 1 mM
sample_conditions_1: ionic strength: 50 mM; pH: 6.0; pressure: 1 atm; temperature: 313 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N TROSY | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HMQC | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
| 3D TROSY-HN(COCA)CB | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
| 3D TROSY-HNCACB | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
| 3D TROSY-HNCA | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-15N NOESY-TROSY | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
| 4D 13C/15 NOESY | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
| 3D TROSY-HNCO | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
| 3D TROSY-HNCO (1J HN couplings) | DNACzrA_sample_1 | anisotropic | sample_conditions_1 |
| 3D TROSY-HNCO (1J COCA couplings) | DNACzrA_sample_1 | anisotropic | sample_conditions_1 |
| 3D TROSY-HNCO (1J NCA couplings) | DNACzrA_sample_1 | anisotropic | sample_conditions_1 |
| 2D IPAP-HSQC | DNACzrA_sample_1 | anisotropic | sample_conditions_1 |
| 3D HMCM[CG]CBCA | DNACzrA_sample_1 | isotropic | sample_conditions_1 |
Software:
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
SPARKY, Goddard - chemical shift assignment, data analysis, peak picking
MARS, (MARS)-Jung and Zweckstetter - chemical shift assignment
NMR spectrometers:
- Varian INOVA 600 MHz
- Varian INOVA 800 MHz
- Varian INOVA 900 MHz
Related Database Links:
| BMRB | 15177 7376 |
| PDB | |
| DBJ | BAA36687 BAB43231 BAB58307 BAB95934 BAF68321 |
| EMBL | CAG41214 CAG43856 CAI81718 CAQ50573 CBI50151 |
| GB | AAC32484 AAW38447 ABD21735 ABD31419 ABQ49963 |
| REF | NP_372669 NP_375252 NP_646886 WP_000003755 WP_000003756 |
Download simulated HSQC data in one of the following formats:
CSV: Backbone
or all simulated shifts
SPARKY: Backbone
or all simulated shifts