BMRB Entry 6115
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6115
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
NMR-STAR v2.1 text file (deprecated)
XML gzip file.
RDF gzip file.
All files associated with the entry
Title: Structural and Functional Analysis of a picornaviral Internal cis-acting replication element PubMed: 15314212
Deposition date: 2004-02-25 Original release date: 2004-09-28
Authors: Kaluarachchi, Kumaralal; Thiviyanathan, Varatharasa
Citation: Thiviyanathan, Varatharasa; Yang, Y.; Kaluarachchi, Kumaralal; Rijnbrand, R.; Gorenstein, D.; Lemon, S.. "High resolution Structure of a Picornaviral Internal Cis-acting RNA Replication Element (cre)" Proc. Natl. Acad. Sci. U.S.A. 101, 12688-12693 (2004).
Assembly members:
Cis-acting replication element, polymer, 34 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: viruses Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
Cis-acting replication element: GGUCAUCGUUGAGAAAACGA
AACAGACGGUGGCC
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 268 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | cre | 1 |
Entities:
Entity 1, cre 34 residues - Formula weight is not available
| 1 | G | G | U | C | A | U | C | G | U | U | ||||
| 2 | G | A | G | A | A | A | A | C | G | A | ||||
| 3 | A | A | C | A | G | A | C | G | G | U | ||||
| 4 | G | G | C | C |
Samples:
sample_1: Cis-acting replication element, [U-13C; U-15N], 0.8 2.0 mM
ex-cond_1: pH: 6.8; temperature: 298 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1H-15N HSQC | sample_1 | not available | ex-cond_1 |
Software:
FELIX v2000 - peak assignmnets, volume measurements
NMR spectrometers:
- Varian UnityPlus 600 MHz
- Varian UnityPlus 750 MHz